\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515059058:

Variant ID: vg0515059058 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 15059058
Reference Allele: CAAlternative Allele: TA,C
Primary Allele: CASecondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTAGGCCCTTAGAAAACTTCCAACAGAAATCAGCTAGTTTCCACCCCTCGCTCTCACGAGATCACGCTTGCGCACGTGCCCCTTCGTCGCCCCTCTCACG[CA/TA,C]
GTACCATGCCGGCAGATCAACCCGACCGGTACACGTGCACCCCCAGTTTTCAACATGTACACCAGCAATTCCAGCAGGCAGGAAAGCACCAACTAGCAGC

Reverse complement sequence

GCTGCTAGTTGGTGCTTTCCTGCCTGCTGGAATTGCTGGTGTACATGTTGAAAACTGGGGGTGCACGTGTACCGGTCGGGTTGATCTGCCGGCATGGTAC[TG/TA,G]
CGTGAGAGGGGCGACGAAGGGGCACGTGCGCAAGCGTGATCTCGTGAGAGCGAGGGGTGGAAACTAGCTGATTTCTGTTGGAAGTTTTCTAAGGGCCTAC

Allele Frequencies:

Populations Population SizeFrequency of CA(primary allele) Frequency of TA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.70% 3.10% 1.21% 0.00% NA
All Indica  2759 98.80% 0.10% 1.05% 0.00% NA
All Japonica  1512 88.90% 9.50% 1.59% 0.00% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 97.10% 0.00% 2.86% 0.00% NA
Indica II  465 99.60% 0.00% 0.43% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 0.40% 1.27% 0.00% NA
Temperate Japonica  767 96.50% 3.00% 0.52% 0.00% NA
Tropical Japonica  504 78.40% 18.70% 2.98% 0.00% NA
Japonica Intermediate  241 86.70% 11.20% 2.07% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0515059058 CA -> TA LOC_Os05g25870.1 upstream_gene_variant ; 3030.0bp to feature; MODIFIER silent_mutation Average:67.547; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0515059058 CA -> TA LOC_Os05g25880.1 upstream_gene_variant ; 805.0bp to feature; MODIFIER silent_mutation Average:67.547; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0515059058 CA -> TA LOC_Os05g25890.1 upstream_gene_variant ; 2427.0bp to feature; MODIFIER silent_mutation Average:67.547; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0515059058 CA -> TA LOC_Os05g25870.2 upstream_gene_variant ; 2586.0bp to feature; MODIFIER silent_mutation Average:67.547; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0515059058 CA -> TA LOC_Os05g25860.1 downstream_gene_variant ; 4486.0bp to feature; MODIFIER silent_mutation Average:67.547; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0515059058 CA -> TA LOC_Os05g25880-LOC_Os05g25890 intergenic_region ; MODIFIER silent_mutation Average:67.547; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0515059058 CA -> C LOC_Os05g25870.1 upstream_gene_variant ; 3031.0bp to feature; MODIFIER N Average:67.547; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0515059058 CA -> C LOC_Os05g25880.1 upstream_gene_variant ; 806.0bp to feature; MODIFIER N Average:67.547; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0515059058 CA -> C LOC_Os05g25890.1 upstream_gene_variant ; 2426.0bp to feature; MODIFIER N Average:67.547; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0515059058 CA -> C LOC_Os05g25870.2 upstream_gene_variant ; 2587.0bp to feature; MODIFIER N Average:67.547; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0515059058 CA -> C LOC_Os05g25860.1 downstream_gene_variant ; 4487.0bp to feature; MODIFIER N Average:67.547; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0515059058 CA -> C LOC_Os05g25880-LOC_Os05g25890 intergenic_region ; MODIFIER N Average:67.547; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0515059058 CA C -0.02 0.01 0.03 0.01 0.04 0.07
vg0515059058 CA TA 0.09 0.04 -0.01 0.02 0.05 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0515059058 NA 6.46E-07 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515059058 NA 7.65E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515059058 2.61E-06 5.78E-14 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515059058 NA 2.04E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515059058 NA 5.26E-15 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515059058 NA 2.07E-13 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515059058 2.91E-07 6.09E-15 mr1410_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515059058 NA 6.67E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515059058 NA 1.05E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515059058 NA 4.90E-16 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515059058 NA 8.90E-06 mr1836_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251