\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514963706:

Variant ID: vg0514963706 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14963706
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCTGAACGGGGCCAACGCCCAGCTTGAAGGTATCGACAAGCGTATCAACGAGGTCTTGAAGCAGGAGTGTCGTCGGTCGAGCCGATATGCAGGAGGGCA[T/C]
GTGCTGGCCTGTATACGAGATCACCATCCACAGCTGCGCCTTGAGTTCCTCCACGAGGGGTTCGCACGTTCTTGGAGAACTGATGCAGAGATAGACCAGC

Reverse complement sequence

GCTGGTCTATCTCTGCATCAGTTCTCCAAGAACGTGCGAACCCCTCGTGGAGGAACTCAAGGCGCAGCTGTGGATGGTGATCTCGTATACAGGCCAGCAC[A/G]
TGCCCTCCTGCATATCGGCTCGACCGACGACACTCCTGCTTCAAGACCTCGTTGATACGCTTGTCGATACCTTCAAGCTGGGCGTTGGCCCCGTTCAGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.90% 40.10% 4.40% 9.61% NA
All Indica  2759 28.50% 57.30% 3.41% 10.76% NA
All Japonica  1512 71.40% 15.00% 4.43% 9.19% NA
Aus  269 68.40% 19.70% 11.90% 0.00% NA
Indica I  595 19.70% 73.30% 3.03% 4.03% NA
Indica II  465 38.10% 36.60% 3.66% 21.72% NA
Indica III  913 28.90% 55.60% 3.72% 11.72% NA
Indica Intermediate  786 29.00% 59.50% 3.18% 8.27% NA
Temperate Japonica  767 91.90% 2.50% 2.87% 2.74% NA
Tropical Japonica  504 42.90% 37.30% 5.95% 13.89% NA
Japonica Intermediate  241 65.60% 8.30% 6.22% 19.92% NA
VI/Aromatic  96 76.00% 5.20% 7.29% 11.46% NA
Intermediate  90 54.40% 28.90% 8.89% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514963706 T -> DEL LOC_Os05g25720.1 N frameshift_variant Average:33.639; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg0514963706 T -> C LOC_Os05g25720.1 synonymous_variant ; p.His562His; LOW synonymous_codon Average:33.639; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514963706 NA 2.19E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514963706 NA 8.92E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514963706 5.42E-09 5.42E-09 mr1076_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514963706 2.87E-06 1.69E-08 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514963706 2.98E-07 2.90E-11 mr1083_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514963706 8.21E-06 NA mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514963706 NA 4.98E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514963706 NA 5.51E-08 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514963706 7.92E-08 2.26E-10 mr1408_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251