Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514934174:

Variant ID: vg0514934174 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 14934174
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.14, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCTACTTCCTCCATACTCGCAAAGTAAGTCGTTTAGGACAATGTTTAAGTCAAACATTAGAAATATAAATCATTAATAACTCTCAAGTTGTTGGGTTT[A/G]
AAAATGTAAAAAATATATGAATAGATTTGTCTTGAAAAATACTTTCATAAAAGTATACATATATCACTTTTCAATAAATATTTTTATGAAAACAAGAAGT

Reverse complement sequence

ACTTCTTGTTTTCATAAAAATATTTATTGAAAAGTGATATATGTATACTTTTATGAAAGTATTTTTCAAGACAAATCTATTCATATATTTTTTACATTTT[T/C]
AAACCCAACAACTTGAGAGTTATTAATGATTTATATTTCTAATGTTTGACTTAAACATTGTCCTAAACGACTTACTTTGCGAGTATGGAGGAAGTAGAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.20%	35.30%	0.44%	0.11%	NA
All Indica	2759	86.50%	12.70%	0.62%	0.14%	NA
All Japonica	1512	21.60%	78.30%	0.13%	0.00%	NA
Aus	269	99.30%	0.40%	0.00%	0.37%	NA
Indica I	595	92.40%	6.40%	0.84%	0.34%	NA
Indica II	465	73.10%	26.00%	0.65%	0.22%	NA
Indica III	913	85.30%	14.10%	0.55%	0.00%	NA
Indica Intermediate	786	91.30%	8.00%	0.51%	0.13%	NA
Temperate Japonica	767	5.60%	94.30%	0.13%	0.00%	NA
Tropical Japonica	504	46.40%	53.40%	0.20%	0.00%	NA
Japonica Intermediate	241	20.30%	79.70%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	51.10%	46.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0514934174	A -> DEL	N	N	silent_mutation	Average:34.164; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0514934174	A -> G	LOC_Os05g25680.1	upstream_gene_variant ; 2951.0bp to feature; MODIFIER	silent_mutation	Average:34.164; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0514934174	A -> G	LOC_Os05g25670.1	downstream_gene_variant ; 1201.0bp to feature; MODIFIER	silent_mutation	Average:34.164; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0514934174	A -> G	LOC_Os05g25660-LOC_Os05g25670	intergenic_region ; MODIFIER	silent_mutation	Average:34.164; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0514934174	NA	3.77E-07	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934174	NA	1.55E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934174	NA	4.45E-07	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934174	NA	9.21E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934174	NA	2.90E-16	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934174	7.01E-06	NA	mr1712	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934174	NA	7.08E-08	mr1862	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934174	NA	3.41E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934174	NA	1.97E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934174	NA	1.71E-06	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934174	NA	3.70E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251