\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514934001:

Variant ID: vg0514934001 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14934001
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCAATCGCTTCTCTCCTCGCCCTCTATCTGGTGACCCAGAAGTCAATAAATATATTTTTATTTGTTTGTGTTGTTAGAGCAGGTACGTACAACAGCAT[A/G]
CTATAAGGCTATCCCCAATTCTCCATGTGACATAGTTTCCATAGCATTAAATGCATTGTCACATAAGTAAAAATTCTACTTCCTCCATACTCGCAAAGTA

Reverse complement sequence

TACTTTGCGAGTATGGAGGAAGTAGAATTTTTACTTATGTGACAATGCATTTAATGCTATGGAAACTATGTCACATGGAGAATTGGGGATAGCCTTATAG[T/C]
ATGCTGTTGTACGTACCTGCTCTAACAACACAAACAAATAAAAATATATTTATTGACTTCTGGGTCACCAGATAGAGGGCGAGGAGAGAAGCGATTGAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 37.90% 0.34% 1.57% NA
All Indica  2759 84.10% 12.80% 0.47% 2.61% NA
All Japonica  1512 21.60% 78.30% 0.07% 0.07% NA
Aus  269 58.40% 41.30% 0.37% 0.00% NA
Indica I  595 91.40% 5.70% 0.50% 2.35% NA
Indica II  465 72.00% 25.80% 0.43% 1.72% NA
Indica III  913 83.70% 15.00% 0.11% 1.20% NA
Indica Intermediate  786 86.10% 8.00% 0.89% 4.96% NA
Temperate Japonica  767 5.70% 94.10% 0.13% 0.00% NA
Tropical Japonica  504 46.40% 53.40% 0.00% 0.20% NA
Japonica Intermediate  241 19.90% 80.10% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 43.30% 54.40% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514934001 A -> DEL N N silent_mutation Average:34.806; most accessible tissue: Minghui63 root, score: 58.187 N N N N
vg0514934001 A -> G LOC_Os05g25680.1 upstream_gene_variant ; 3124.0bp to feature; MODIFIER silent_mutation Average:34.806; most accessible tissue: Minghui63 root, score: 58.187 N N N N
vg0514934001 A -> G LOC_Os05g25670.1 downstream_gene_variant ; 1374.0bp to feature; MODIFIER silent_mutation Average:34.806; most accessible tissue: Minghui63 root, score: 58.187 N N N N
vg0514934001 A -> G LOC_Os05g25660-LOC_Os05g25670 intergenic_region ; MODIFIER silent_mutation Average:34.806; most accessible tissue: Minghui63 root, score: 58.187 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514934001 NA 3.90E-07 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934001 NA 1.56E-08 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934001 2.06E-06 2.06E-06 mr1208 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934001 NA 9.93E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934001 NA 1.44E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934001 NA 6.33E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934001 NA 4.32E-07 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934001 NA 5.40E-06 mr1603 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934001 NA 2.08E-17 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934001 NA 2.29E-09 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934001 NA 4.51E-07 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934001 NA 3.92E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934001 NA 1.50E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934001 NA 3.24E-08 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514934001 NA 6.11E-13 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251