\
| Variant ID: vg0514921243 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 14921243 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTAATTATACAAAACCGGTCATCCGAGATCCTTCGGCGGTTTTGATCCCAGTTTTGTTCTACGTGACAGCTAAGTCAGCGTGGGACCCATGTGGGCCCCA[C/T]
GTGTCAGCCAACCACTCTCTCTCCCCTTTTCTCTCCCATCTCTCTCACTTCTCTCCTCTCGAGCAAGCCGGGGCGGGTGGGGAGGAGGTCGCAAGGACGG
CCGTCCTTGCGACCTCCTCCCCACCCGCCCCGGCTTGCTCGAGAGGAGAGAAGTGAGAGAGATGGGAGAGAAAAGGGGAGAGAGAGTGGTTGGCTGACAC[G/A]
TGGGGCCCACATGGGTCCCACGCTGACTTAGCTGTCACGTAGAACAAAACTGGGATCAAAACCGCCGAAGGATCTCGGATGACCGGTTTTGTATAATTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.40% | 2.40% | 1.14% | 0.00% | NA |
| All Indica | 2759 | 94.00% | 4.10% | 1.92% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 74.80% | 16.30% | 8.82% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 94.80% | 3.90% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0514921243 | C -> T | LOC_Os05g25660.1 | upstream_gene_variant ; 149.0bp to feature; MODIFIER | silent_mutation | Average:67.28; most accessible tissue: Callus, score: 95.649 | N | N | N | N |
| vg0514921243 | C -> T | LOC_Os05g25650-LOC_Os05g25660 | intergenic_region ; MODIFIER | silent_mutation | Average:67.28; most accessible tissue: Callus, score: 95.649 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0514921243 | NA | 9.73E-09 | mr1045 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514921243 | NA | 3.30E-06 | mr1045 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514921243 | NA | 6.84E-06 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514921243 | NA | 7.26E-06 | mr1790 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514921243 | NA | 5.64E-06 | mr1941 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514921243 | NA | 6.14E-07 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514921243 | NA | 2.44E-06 | mr1425_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514921243 | NA | 3.42E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514921243 | NA | 5.11E-06 | mr1977_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |