Search for Variation information by Variation ID:
Detailed information for vg0514862455:
| Variant ID: vg0514862455 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 14862455 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.85, G: 0.15, others allele: 0.00, population size: 103. )
Flanking Sequence (100 bp) in Reference Genome:
AAAAAAGAAAAGAAAAAAATTTTAGATAAGTTGGATTTGCTAGATAAAAAGGCAGAAAATTCCCTTTTGAGTCCGGAAGAATTGGATATTAGATGGTTTT[G/A]
TAGGAATAGATTATCCTCTATTCTAAGAGAGGAGGAGATCAAATGGTATCAGAGGGCTAAATCAAAGGATATTTTAGAGGGTGATTCTAATACAAAGTAT
Reverse complement sequence
ATACTTTGTATTAGAATCACCCTCTAAAATATCCTTTGATTTAGCCCTCTGATACCATTTGATCTCCTCCTCTCTTAGAATAGAGGATAATCTATTCCTA[C/T]
AAAACCATCTAATATCCAATTCTTCCGGACTCAAAAGGGAATTTTCTGCCTTTTTATCTAGCAAATCCAACTTATCTAAAATTTTTTTCTTTTCTTTTTT
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.10% | 27.00% | 2.54% | 30.43% | NA |
| All Indica | 2759 | 12.50% | 36.50% | 4.02% | 46.97% | NA |
| All Japonica | 1512 | 92.30% | 0.60% | 0.13% | 6.94% | NA |
| Aus | 269 | 2.60% | 89.60% | 1.49% | 6.32% | NA |
| Indica I | 595 | 7.90% | 48.70% | 2.02% | 41.34% | NA |
| Indica II | 465 | 29.00% | 14.20% | 1.51% | 55.27% | NA |
| Indica III | 913 | 7.90% | 37.60% | 8.21% | 46.33% | NA |
| Indica Intermediate | 786 | 11.70% | 39.10% | 2.16% | 47.07% | NA |
| Temperate Japonica | 767 | 97.80% | 0.00% | 0.00% | 2.22% | NA |
| Tropical Japonica | 504 | 82.10% | 1.40% | 0.40% | 16.07% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.80% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 15.60% | 3.33% | 22.22% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0514862455 | G -> DEL | LOC_Os05g25570.1 | N | frameshift_variant | Average:16.525; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0514862455 | G -> A | LOC_Os05g25570.1 | missense_variant ; p.Cys973Tyr; MODERATE | nonsynonymous_codon ; C973Y | Average:16.525; most accessible tissue: Zhenshan97 panicle, score: 28.447 | benign  |
-0.22 |
TOLERATED | 0.70 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0514862455 | NA | 4.27E-10 | mr1227 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514862455 | NA | 4.82E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514862455 | NA | 8.95E-09 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514862455 | NA | 2.10E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514862455 | NA | 2.21E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |