\
| Variant ID: vg0514820986 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 14820986 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, T: 0.06, others allele: 0.00, population size: 97. )
ATTAGAAATAATAAAAATTCAGAATTAAAAAAAAGAAATATTAAAAGACAAGTCTAGAGTCCATATAGAAATATATATATTTTACAAATAACTAAAATTT[T/G]
ATATTAAAAATAATTAATAACTAACACGTATATAAAATACAATATGAATATTACACATTAATAGTTTCGTAAAGTTATTGCAAAATTTAAAATCATGTTG
CAACATGATTTTAAATTTTGCAATAACTTTACGAAACTATTAATGTGTAATATTCATATTGTATTTTATATACGTGTTAGTTATTAATTATTTTTAATAT[A/C]
AAATTTTAGTTATTTGTAAAATATATATATTTCTATATGGACTCTAGACTTGTCTTTTAATATTTCTTTTTTTTAATTCTGAATTTTTATTATTTCTAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.50% | 45.00% | 1.33% | 1.14% | NA |
| All Indica | 2759 | 74.60% | 21.70% | 1.78% | 1.85% | NA |
| All Japonica | 1512 | 8.30% | 91.30% | 0.33% | 0.00% | NA |
| Aus | 269 | 97.80% | 0.40% | 1.49% | 0.37% | NA |
| Indica I | 595 | 60.70% | 28.10% | 4.87% | 6.39% | NA |
| Indica II | 465 | 65.20% | 32.90% | 1.51% | 0.43% | NA |
| Indica III | 913 | 87.40% | 11.70% | 0.33% | 0.55% | NA |
| Indica Intermediate | 786 | 76.00% | 22.00% | 1.27% | 0.76% | NA |
| Temperate Japonica | 767 | 2.30% | 97.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 19.20% | 80.00% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 94.80% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 35.60% | 60.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0514820986 | T -> DEL | N | N | silent_mutation | Average:20.657; most accessible tissue: Callus, score: 27.443 | N | N | N | N |
| vg0514820986 | T -> G | LOC_Os05g25500.1 | upstream_gene_variant ; 4322.0bp to feature; MODIFIER | silent_mutation | Average:20.657; most accessible tissue: Callus, score: 27.443 | N | N | N | N |
| vg0514820986 | T -> G | LOC_Os05g25480.1 | downstream_gene_variant ; 2318.0bp to feature; MODIFIER | silent_mutation | Average:20.657; most accessible tissue: Callus, score: 27.443 | N | N | N | N |
| vg0514820986 | T -> G | LOC_Os05g25490.1 | downstream_gene_variant ; 918.0bp to feature; MODIFIER | silent_mutation | Average:20.657; most accessible tissue: Callus, score: 27.443 | N | N | N | N |
| vg0514820986 | T -> G | LOC_Os05g25480-LOC_Os05g25490 | intergenic_region ; MODIFIER | silent_mutation | Average:20.657; most accessible tissue: Callus, score: 27.443 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0514820986 | NA | 7.01E-09 | mr1378_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514820986 | NA | 1.60E-07 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514820986 | NA | 3.49E-09 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514820986 | 4.27E-06 | 7.42E-08 | mr1647_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514820986 | NA | 4.30E-06 | mr1669_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514820986 | NA | 2.84E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514820986 | NA | 3.49E-07 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |