\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514820986:

Variant ID: vg0514820986 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14820986
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, T: 0.06, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAGAAATAATAAAAATTCAGAATTAAAAAAAAGAAATATTAAAAGACAAGTCTAGAGTCCATATAGAAATATATATATTTTACAAATAACTAAAATTT[T/G]
ATATTAAAAATAATTAATAACTAACACGTATATAAAATACAATATGAATATTACACATTAATAGTTTCGTAAAGTTATTGCAAAATTTAAAATCATGTTG

Reverse complement sequence

CAACATGATTTTAAATTTTGCAATAACTTTACGAAACTATTAATGTGTAATATTCATATTGTATTTTATATACGTGTTAGTTATTAATTATTTTTAATAT[A/C]
AAATTTTAGTTATTTGTAAAATATATATATTTCTATATGGACTCTAGACTTGTCTTTTAATATTTCTTTTTTTTAATTCTGAATTTTTATTATTTCTAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.50% 45.00% 1.33% 1.14% NA
All Indica  2759 74.60% 21.70% 1.78% 1.85% NA
All Japonica  1512 8.30% 91.30% 0.33% 0.00% NA
Aus  269 97.80% 0.40% 1.49% 0.37% NA
Indica I  595 60.70% 28.10% 4.87% 6.39% NA
Indica II  465 65.20% 32.90% 1.51% 0.43% NA
Indica III  913 87.40% 11.70% 0.33% 0.55% NA
Indica Intermediate  786 76.00% 22.00% 1.27% 0.76% NA
Temperate Japonica  767 2.30% 97.50% 0.13% 0.00% NA
Tropical Japonica  504 19.20% 80.00% 0.79% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 94.80% 1.04% 2.08% NA
Intermediate  90 35.60% 60.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514820986 T -> DEL N N silent_mutation Average:20.657; most accessible tissue: Callus, score: 27.443 N N N N
vg0514820986 T -> G LOC_Os05g25500.1 upstream_gene_variant ; 4322.0bp to feature; MODIFIER silent_mutation Average:20.657; most accessible tissue: Callus, score: 27.443 N N N N
vg0514820986 T -> G LOC_Os05g25480.1 downstream_gene_variant ; 2318.0bp to feature; MODIFIER silent_mutation Average:20.657; most accessible tissue: Callus, score: 27.443 N N N N
vg0514820986 T -> G LOC_Os05g25490.1 downstream_gene_variant ; 918.0bp to feature; MODIFIER silent_mutation Average:20.657; most accessible tissue: Callus, score: 27.443 N N N N
vg0514820986 T -> G LOC_Os05g25480-LOC_Os05g25490 intergenic_region ; MODIFIER silent_mutation Average:20.657; most accessible tissue: Callus, score: 27.443 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514820986 NA 7.01E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514820986 NA 1.60E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514820986 NA 3.49E-09 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514820986 4.27E-06 7.42E-08 mr1647_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514820986 NA 4.30E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514820986 NA 2.84E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514820986 NA 3.49E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251