Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514820986:

Variant ID: vg0514820986 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 14820986
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, T: 0.06, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

ATTAGAAATAATAAAAATTCAGAATTAAAAAAAAGAAATATTAAAAGACAAGTCTAGAGTCCATATAGAAATATATATATTTTACAAATAACTAAAATTT[T/G]
ATATTAAAAATAATTAATAACTAACACGTATATAAAATACAATATGAATATTACACATTAATAGTTTCGTAAAGTTATTGCAAAATTTAAAATCATGTTG

Reverse complement sequence

CAACATGATTTTAAATTTTGCAATAACTTTACGAAACTATTAATGTGTAATATTCATATTGTATTTTATATACGTGTTAGTTATTAATTATTTTTAATAT[A/C]
AAATTTTAGTTATTTGTAAAATATATATATTTCTATATGGACTCTAGACTTGTCTTTTAATATTTCTTTTTTTTAATTCTGAATTTTTATTATTTCTAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	45.00%	1.33%	1.14%	NA
All Indica	2759	74.60%	21.70%	1.78%	1.85%	NA
All Japonica	1512	8.30%	91.30%	0.33%	0.00%	NA
Aus	269	97.80%	0.40%	1.49%	0.37%	NA
Indica I	595	60.70%	28.10%	4.87%	6.39%	NA
Indica II	465	65.20%	32.90%	1.51%	0.43%	NA
Indica III	913	87.40%	11.70%	0.33%	0.55%	NA
Indica Intermediate	786	76.00%	22.00%	1.27%	0.76%	NA
Temperate Japonica	767	2.30%	97.50%	0.13%	0.00%	NA
Tropical Japonica	504	19.20%	80.00%	0.79%	0.00%	NA
Japonica Intermediate	241	4.60%	95.40%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	94.80%	1.04%	2.08%	NA
Intermediate	90	35.60%	60.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0514820986	T -> DEL	N	N	silent_mutation	Average:20.657; most accessible tissue: Callus, score: 27.443	N	N	N	N
vg0514820986	T -> G	LOC_Os05g25500.1	upstream_gene_variant ; 4322.0bp to feature; MODIFIER	silent_mutation	Average:20.657; most accessible tissue: Callus, score: 27.443	N	N	N	N
vg0514820986	T -> G	LOC_Os05g25480.1	downstream_gene_variant ; 2318.0bp to feature; MODIFIER	silent_mutation	Average:20.657; most accessible tissue: Callus, score: 27.443	N	N	N	N
vg0514820986	T -> G	LOC_Os05g25490.1	downstream_gene_variant ; 918.0bp to feature; MODIFIER	silent_mutation	Average:20.657; most accessible tissue: Callus, score: 27.443	N	N	N	N
vg0514820986	T -> G	LOC_Os05g25480-LOC_Os05g25490	intergenic_region ; MODIFIER	silent_mutation	Average:20.657; most accessible tissue: Callus, score: 27.443	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0514820986	NA	7.01E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514820986	NA	1.60E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514820986	NA	3.49E-09	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514820986	4.27E-06	7.42E-08	mr1647_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514820986	NA	4.30E-06	mr1669_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514820986	NA	2.84E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514820986	NA	3.49E-07	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251