\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514712143:

Variant ID: vg0514712143 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14712143
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTTCCCGTGTTGGGATTGCCGGGGGGTGTTAAACAGATAGATAGTTCGGATAGGAACATATCTGTTGACAAGATAAGATAGAGTTTAGTTTGTTTCTT[A/G]
TTTTTCTGTTTCCTTTCTTCTCGATGAAGATGTAATCTATAAACTCCTATGTACACGCCACGCCAGGGGCTGTTTCTGGCTATATAACACGGGCCGTGGA

Reverse complement sequence

TCCACGGCCCGTGTTATATAGCCAGAAACAGCCCCTGGCGTGGCGTGTACATAGGAGTTTATAGATTACATCTTCATCGAGAAGAAAGGAAACAGAAAAA[T/C]
AAGAAACAAACTAAACTCTATCTTATCTTGTCAACAGATATGTTCCTATCCGAACTATCTATCTGTTTAACACCCCCCGGCAATCCCAACACGGGAACCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.40% 44.00% 0.51% 0.06% NA
All Indica  2759 84.20% 15.10% 0.62% 0.07% NA
All Japonica  1512 2.10% 97.80% 0.07% 0.00% NA
Aus  269 81.80% 18.20% 0.00% 0.00% NA
Indica I  595 82.70% 16.50% 0.84% 0.00% NA
Indica II  465 75.30% 24.10% 0.43% 0.22% NA
Indica III  913 89.80% 10.10% 0.11% 0.00% NA
Indica Intermediate  786 84.10% 14.60% 1.15% 0.13% NA
Temperate Japonica  767 2.90% 97.10% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 98.80% 0.20% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 41.10% 51.10% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514712143 A -> DEL N N silent_mutation Average:39.096; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0514712143 A -> G LOC_Os05g25340.1 upstream_gene_variant ; 2356.0bp to feature; MODIFIER silent_mutation Average:39.096; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0514712143 A -> G LOC_Os05g25350.1 upstream_gene_variant ; 4463.0bp to feature; MODIFIER silent_mutation Average:39.096; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0514712143 A -> G LOC_Os05g25330.1 downstream_gene_variant ; 18.0bp to feature; MODIFIER silent_mutation Average:39.096; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0514712143 A -> G LOC_Os05g25330-LOC_Os05g25340 intergenic_region ; MODIFIER silent_mutation Average:39.096; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514712143 3.30E-07 2.43E-33 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 NA 2.47E-11 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 NA 1.06E-33 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 NA 1.99E-06 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 5.16E-10 2.15E-38 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 1.43E-06 1.33E-08 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 NA 5.62E-26 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 NA 1.67E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 NA 6.08E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 NA 1.05E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 NA 7.41E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 NA 2.06E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 NA 1.31E-12 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 NA 2.45E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 NA 2.18E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 NA 3.22E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 3.75E-06 NA mr1545_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 3.60E-10 7.54E-47 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 1.30E-06 8.71E-10 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 NA 6.39E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 NA 2.83E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 2.43E-08 4.40E-38 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143 5.11E-07 3.90E-07 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251