Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514712143:

Variant ID: vg0514712143 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 14712143
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTTCCCGTGTTGGGATTGCCGGGGGGTGTTAAACAGATAGATAGTTCGGATAGGAACATATCTGTTGACAAGATAAGATAGAGTTTAGTTTGTTTCTT[A/G]
TTTTTCTGTTTCCTTTCTTCTCGATGAAGATGTAATCTATAAACTCCTATGTACACGCCACGCCAGGGGCTGTTTCTGGCTATATAACACGGGCCGTGGA

Reverse complement sequence

TCCACGGCCCGTGTTATATAGCCAGAAACAGCCCCTGGCGTGGCGTGTACATAGGAGTTTATAGATTACATCTTCATCGAGAAGAAAGGAAACAGAAAAA[T/C]
AAGAAACAAACTAAACTCTATCTTATCTTGTCAACAGATATGTTCCTATCCGAACTATCTATCTGTTTAACACCCCCCGGCAATCCCAACACGGGAACCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.40%	44.00%	0.51%	0.06%	NA
All Indica	2759	84.20%	15.10%	0.62%	0.07%	NA
All Japonica	1512	2.10%	97.80%	0.07%	0.00%	NA
Aus	269	81.80%	18.20%	0.00%	0.00%	NA
Indica I	595	82.70%	16.50%	0.84%	0.00%	NA
Indica II	465	75.30%	24.10%	0.43%	0.22%	NA
Indica III	913	89.80%	10.10%	0.11%	0.00%	NA
Indica Intermediate	786	84.10%	14.60%	1.15%	0.13%	NA
Temperate Japonica	767	2.90%	97.10%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	98.80%	0.20%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	41.10%	51.10%	6.67%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0514712143	A -> DEL	N	N	silent_mutation	Average:39.096; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0514712143	A -> G	LOC_Os05g25340.1	upstream_gene_variant ; 2356.0bp to feature; MODIFIER	silent_mutation	Average:39.096; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0514712143	A -> G	LOC_Os05g25350.1	upstream_gene_variant ; 4463.0bp to feature; MODIFIER	silent_mutation	Average:39.096; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0514712143	A -> G	LOC_Os05g25330.1	downstream_gene_variant ; 18.0bp to feature; MODIFIER	silent_mutation	Average:39.096; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0514712143	A -> G	LOC_Os05g25330-LOC_Os05g25340	intergenic_region ; MODIFIER	silent_mutation	Average:39.096; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0514712143	3.30E-07	2.43E-33	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	NA	2.47E-11	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	NA	1.06E-33	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	NA	1.99E-06	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	5.16E-10	2.15E-38	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	1.43E-06	1.33E-08	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	NA	5.62E-26	mr1074_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	NA	1.67E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	NA	6.08E-13	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	NA	1.05E-15	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	NA	7.41E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	NA	2.06E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	NA	1.31E-12	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	NA	2.45E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	NA	2.18E-08	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	NA	3.22E-14	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	3.75E-06	NA	mr1545_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	3.60E-10	7.54E-47	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	1.30E-06	8.71E-10	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	NA	6.39E-11	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	NA	2.83E-06	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	2.43E-08	4.40E-38	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514712143	5.11E-07	3.90E-07	mr1873_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251