\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514684611:

Variant ID: vg0514684611 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14684611
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.11, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GCATTGTTGAAGCAGGAAATACTTGGTTGAGTTGGTGTTGACGCTGTTGTCGACGAAGCTGGATGACATAGTAGTAGAACCTTGAGCACCAAGTCCTCCT[G/A]
CCTGGCGCGCCACTGTCGACGGGTGATACCCGTAGACCGGATATAGAAGGTATTGGGGTACGTTGGTACAAGGGTCTATGTAGTACGACATCAAGCAGAC

Reverse complement sequence

GTCTGCTTGATGTCGTACTACATAGACCCTTGTACCAACGTACCCCAATACCTTCTATATCCGGTCTACGGGTATCACCCGTCGACAGTGGCGCGCCAGG[C/T]
AGGAGGACTTGGTGCTCAAGGTTCTACTACTATGTCATCCAGCTTCGTCGACAACAGCGTCAACACCAACTCAACCAAGTATTTCCTGCTTCAACAATGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 44.00% 0.13% 0.57% NA
All Indica  2759 84.10% 15.00% 0.18% 0.72% NA
All Japonica  1512 2.20% 97.80% 0.00% 0.07% NA
Aus  269 81.40% 18.60% 0.00% 0.00% NA
Indica I  595 82.40% 16.50% 0.34% 0.84% NA
Indica II  465 75.10% 23.90% 0.22% 0.86% NA
Indica III  913 89.80% 10.00% 0.11% 0.11% NA
Indica Intermediate  786 84.00% 14.60% 0.13% 1.27% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.50% 0.00% 0.41% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 41.10% 51.10% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514684611 G -> DEL LOC_Os05g25300.1 N frameshift_variant Average:49.158; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N
vg0514684611 G -> A LOC_Os05g25300.1 synonymous_variant ; p.Gly125Gly; LOW synonymous_codon Average:49.158; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514684611 3.64E-09 7.59E-37 mr1039 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 4.77E-06 3.83E-08 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 5.71E-06 1.95E-12 mr1514 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 2.22E-06 1.25E-36 mr1632 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 NA 7.17E-08 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 1.10E-11 2.69E-40 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 2.61E-07 3.77E-09 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 NA 7.65E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 NA 9.02E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 NA 7.16E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 NA 1.11E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 NA 1.55E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 NA 7.79E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 NA 8.11E-13 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 NA 1.67E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 2.67E-14 3.18E-50 mr1632_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 5.87E-09 2.67E-11 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 NA 7.88E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 NA 6.12E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 2.06E-08 3.16E-39 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514684611 1.85E-06 4.74E-07 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251