\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514682946:

Variant ID: vg0514682946 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14682946
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.60, A: 0.39, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTAACGCGTGTAGGTCGTCTTCGATCGCGTGGCGCTTGTAGGTTCCTTGGAAGTTGGCGACGAACTGCTGCCACAGGTCTGGCCCCGAAGAGATTGAGTA[A/G]
GGCAGGAGATGCATCAGCCATGAACGTGCAGAGCCTTTTAACGCAGTTGGCAAATAATTCGCCAATGCGTTGTCGTCTGCTCCGGCAGCGTAGAGTACTG

Reverse complement sequence

CAGTACTCTACGCTGCCGGAGCAGACGACAACGCATTGGCGAATTATTTGCCAACTGCGTTAAAAGGCTCTGCACGTTCATGGCTGATGCATCTCCTGCC[T/C]
TACTCAATCTCTTCGGGGCCAGACCTGTGGCAGCAGTTCGTCGCCAACTTCCAAGGAACCTACAAGCGCCACGCGATCGAAGACGACCTACACGCGTTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.10% 3.30% 32.20% 18.39% NA
All Indica  2759 18.10% 5.30% 45.85% 30.84% NA
All Japonica  1512 98.00% 0.10% 1.85% 0.07% NA
Aus  269 19.00% 3.70% 73.23% 4.09% NA
Indica I  595 20.50% 2.40% 45.38% 31.76% NA
Indica II  465 26.50% 3.40% 43.44% 26.67% NA
Indica III  913 11.90% 9.20% 45.56% 33.30% NA
Indica Intermediate  786 18.30% 3.90% 47.96% 29.77% NA
Temperate Japonica  767 97.40% 0.10% 2.48% 0.00% NA
Tropical Japonica  504 99.00% 0.00% 0.99% 0.00% NA
Japonica Intermediate  241 97.90% 0.00% 1.66% 0.41% NA
VI/Aromatic  96 93.80% 1.00% 5.21% 0.00% NA
Intermediate  90 63.30% 0.00% 30.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514682946 A -> DEL LOC_Os05g25300.1 N frameshift_variant Average:43.557; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N
vg0514682946 A -> G LOC_Os05g25300.1 synonymous_variant ; p.Pro612Pro; LOW synonymous_codon Average:43.557; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514682946 8.48E-06 6.05E-31 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 6.33E-11 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 5.57E-31 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 5.28E-06 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 9.06E-11 1.45E-36 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 9.23E-08 8.97E-09 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 3.25E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 1.55E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 1.51E-17 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 2.60E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 9.75E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 5.99E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 1.20E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 4.29E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 6.53E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 4.63E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 7.38E-06 mr1545_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 7.08E-12 9.01E-46 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 4.39E-08 1.90E-10 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 3.53E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 1.37E-06 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 1.68E-09 3.82E-39 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 5.45E-09 1.45E-09 mr1873_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514682946 NA 2.72E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251