\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514669939:

Variant ID: vg0514669939 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14669939
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, C: 0.20, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


CCACTATTTCTTATTTCACATGATGACTTGGATGTTGTGTAGAAACCAAATCCCATGCAAGACATGGTTTCCTTCTCTTTCCTCATTTATTTACTTGTCA[T/C]
ATCATTTTTTTATCTTAGATGGCAGCTTATTTAATGCTATGGATATCATTCTAGTCATTGGGTTAGGAATAACCTCATTCTGAAGTTAATTGTAGCAATC

Reverse complement sequence

GATTGCTACAATTAACTTCAGAATGAGGTTATTCCTAACCCAATGACTAGAATGATATCCATAGCATTAAATAAGCTGCCATCTAAGATAAAAAAATGAT[A/G]
TGACAAGTAAATAAATGAGGAAAGAGAAGGAAACCATGTCTTGCATGGGATTTGGTTTCTACACAACATCCAAGTCATCATGTGAAATAAGAAATAGTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 44.10% 0.49% 0.13% NA
All Indica  2759 84.10% 15.00% 0.69% 0.18% NA
All Japonica  1512 2.10% 97.90% 0.07% 0.00% NA
Aus  269 81.40% 18.60% 0.00% 0.00% NA
Indica I  595 82.70% 16.50% 0.67% 0.17% NA
Indica II  465 74.80% 23.70% 1.08% 0.43% NA
Indica III  913 89.70% 10.20% 0.11% 0.00% NA
Indica Intermediate  786 84.10% 14.50% 1.15% 0.25% NA
Temperate Japonica  767 2.90% 97.10% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 98.80% 0.20% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 41.10% 54.40% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514669939 T -> DEL N N silent_mutation Average:60.906; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0514669939 T -> C LOC_Os05g25270.1 upstream_gene_variant ; 1079.0bp to feature; MODIFIER silent_mutation Average:60.906; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0514669939 T -> C LOC_Os05g25280.1 upstream_gene_variant ; 4782.0bp to feature; MODIFIER silent_mutation Average:60.906; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0514669939 T -> C LOC_Os05g25270-LOC_Os05g25280 intergenic_region ; MODIFIER silent_mutation Average:60.906; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514669939 4.23E-08 2.11E-33 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 7.76E-06 4.34E-07 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 NA 7.62E-11 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 NA 5.23E-33 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 NA 2.11E-07 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 1.02E-10 2.21E-37 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 1.82E-08 1.61E-09 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 NA 6.78E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 NA 4.07E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 NA 8.21E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 NA 7.35E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 3.30E-06 NA mr1545_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 7.04E-13 7.45E-47 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 4.23E-09 3.57E-11 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 NA 5.02E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 NA 7.78E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 1.73E-07 4.86E-37 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 4.89E-07 2.62E-07 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514669939 NA 9.59E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251