\
| Variant ID: vg0514649039 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 14649039 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 104. )
CTGGTATATTTTGGTTACAGAGTTCATCCGCAAGCGCACGGATATACTATTGTAGCATTTCACCCGAGAGTATTCCAAGGGTATCGTATTTATTTAATCC[T/C]
GTGGAAAGATCATAGTAGAGAGAACCTGACTAATTATTTATATGTTACTTGTAATAATCATAGTCTAAGCAGGGGTTAAGATAAATCCAAAGGTAGAGTG
CACTCTACCTTTGGATTTATCTTAACCCCTGCTTAGACTATGATTATTACAAGTAACATATAAATAATTAGTCAGGTTCTCTCTACTATGATCTTTCCAC[A/G]
GGATTAAATAAATACGATACCCTTGGAATACTCTCGGGTGAAATGCTACAATAGTATATCCGTGCGCTTGCGGATGAACTCTGTAACCAAAATATACCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.20% | 44.60% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 84.20% | 15.60% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 1.90% | 98.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 81.40% | 18.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.00% | 16.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 74.80% | 25.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 84.40% | 15.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 61.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0514649039 | T -> C | LOC_Os05g25240.1 | downstream_gene_variant ; 1041.0bp to feature; MODIFIER | silent_mutation | Average:29.578; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0514649039 | T -> C | LOC_Os05g25240-LOC_Os05g25250 | intergenic_region ; MODIFIER | silent_mutation | Average:29.578; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0514649039 | 2.21E-07 | 1.83E-35 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514649039 | 1.05E-06 | 1.31E-09 | mr1039 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514649039 | NA | 7.02E-12 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514649039 | NA | 6.50E-36 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514649039 | NA | 2.05E-09 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514649039 | 2.30E-09 | 1.03E-38 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514649039 | 2.91E-07 | 1.88E-09 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514649039 | 1.35E-11 | 3.57E-47 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514649039 | 1.22E-08 | 2.46E-11 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514649039 | NA | 9.65E-35 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514649039 | NA | 5.68E-06 | mr1873_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |