\
| Variant ID: vg0514648404 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 14648404 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 116. )
TGCAATTTGAATTAATTTATGCGGAGAAAGAAAATGAGAGAAGTGCATGACATGTGGACTAGCCATCATTTTTTCCCCCTTATTGATTGGATTAACATAA[C/T]
ATAAGATAAGACCATAATGGTGTAAGTTTACCGATGCAAAATGTTTGTTTGGTTGAGAGGTAAAAAGCATCCAGCTTGGAATTTGTGATTGGATTTTAAC
GTTAAAATCCAATCACAAATTCCAAGCTGGATGCTTTTTACCTCTCAACCAAACAAACATTTTGCATCGGTAAACTTACACCATTATGGTCTTATCTTAT[G/A]
TTATGTTAATCCAATCAATAAGGGGGAAAAAATGATGGCTAGTCCACATGTCATGCACTTCTCTCATTTTCTTTCTCCGCATAAATTAATTCAAATTGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.40% | 48.30% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 22.80% | 76.80% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 62.10% | 37.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 23.40% | 75.80% | 0.84% | 0.00% | NA |
| Indica II | 465 | 25.20% | 74.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 23.20% | 76.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 20.40% | 79.00% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 35.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0514648404 | C -> T | LOC_Os05g25240.1 | downstream_gene_variant ; 406.0bp to feature; MODIFIER | silent_mutation | Average:40.371; most accessible tissue: Callus, score: 73.401 | N | N | N | N |
| vg0514648404 | C -> T | LOC_Os05g25240-LOC_Os05g25250 | intergenic_region ; MODIFIER | silent_mutation | Average:40.371; most accessible tissue: Callus, score: 73.401 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0514648404 | 1.26E-06 | 1.78E-29 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514648404 | NA | 2.96E-27 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514648404 | NA | 3.00E-06 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514648404 | 3.73E-10 | 7.57E-37 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514648404 | 1.01E-08 | 1.73E-09 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514648404 | NA | 6.27E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514648404 | NA | 4.91E-06 | mr1320_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514648404 | NA | 5.78E-13 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514648404 | 1.24E-11 | 9.15E-41 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514648404 | 1.79E-09 | 5.98E-11 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514648404 | 1.05E-07 | 6.47E-33 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514648404 | 1.97E-09 | 5.52E-09 | mr1873_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |