\
| Variant ID: vg0514534416 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 14534416 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 268. )
CAAGTGCAAAGGATAACAAAGGATGGCATAGTAAAGCTCATTTGCATAAACAGAATTTAGTAAACATTTTAAAGAATAATAAATCAATTGAATAATTAAT[C/T]
AGTATTAAATAAACACCATACAACACACCTATCTTGCATAGGCCCAACCTCATTTGAACAACCAACCCCGGTTGTACAAATCAAACCTCCATACCAGGAA
TTCCTGGTATGGAGGTTTGATTTGTACAACCGGGGTTGGTTGTTCAAATGAGGTTGGGCCTATGCAAGATAGGTGTGTTGTATGGTGTTTATTTAATACT[G/A]
ATTAATTATTCAATTGATTTATTATTCTTTAAAATGTTTACTAAATTCTGTTTATGCAAATGAGCTTTACTATGCCATCCTTTGTTATCCTTTGCACTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 4.90% | 2.14% | 0.00% | NA |
| All Indica | 2759 | 88.30% | 8.20% | 3.52% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.30% | 0.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.10% | 1.00% | 3.87% | 0.00% | NA |
| Indica II | 465 | 69.20% | 20.90% | 9.89% | 0.00% | NA |
| Indica III | 913 | 88.50% | 11.00% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 94.30% | 2.80% | 2.93% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.50% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0514534416 | C -> T | LOC_Os05g25100.1 | downstream_gene_variant ; 910.0bp to feature; MODIFIER | silent_mutation | Average:32.697; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0514534416 | C -> T | LOC_Os05g25090-LOC_Os05g25100 | intergenic_region ; MODIFIER | silent_mutation | Average:32.697; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0514534416 | 1.73E-10 | 1.38E-35 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514534416 | 8.96E-09 | 1.49E-20 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514534416 | 6.36E-06 | NA | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514534416 | NA | 4.73E-09 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514534416 | 1.05E-13 | 7.07E-39 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514534416 | 8.42E-11 | 6.72E-22 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514534416 | 6.79E-06 | NA | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514534416 | 1.83E-14 | NA | mr1632_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514534416 | 4.39E-12 | 3.13E-18 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |