\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514453158:

Variant ID: vg0514453158 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14453158
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACGTCAGCGTCCGATTTACATGTAAAAACTACTTTAAACCGATTTTTCTCTTAAATTACTTATCCAAATCATGATTCGATTGCATCATTAAATTTGTTG[C/T]
AATTAAATTTTCAAAACAAGACCACACATGGATATATTCCGATGAATTTTTTTTAGCTTATTATTGAATTATTTTTAAATGTTGCACGATGTTCCACCAG

Reverse complement sequence

CTGGTGGAACATCGTGCAACATTTAAAAATAATTCAATAATAAGCTAAAAAAAATTCATCGGAATATATCCATGTGTGGTCTTGTTTTGAAAATTTAATT[G/A]
CAACAAATTTAATGATGCAATCGAATCATGATTTGGATAAGTAATTTAAGAGAAAAATCGGTTTAAAGTAGTTTTTACATGTAAATCGGACGCTGACGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.50% 7.30% 2.71% 37.45% NA
All Indica  2759 27.60% 7.80% 4.35% 60.31% NA
All Japonica  1512 97.50% 0.80% 0.00% 1.72% NA
Aus  269 37.20% 42.80% 1.49% 18.59% NA
Indica I  595 22.70% 11.10% 2.35% 63.87% NA
Indica II  465 20.90% 0.20% 4.95% 73.98% NA
Indica III  913 31.90% 11.30% 5.59% 51.26% NA
Indica Intermediate  786 30.30% 5.60% 4.07% 60.05% NA
Temperate Japonica  767 97.10% 0.00% 0.00% 2.87% NA
Tropical Japonica  504 97.40% 2.20% 0.00% 0.40% NA
Japonica Intermediate  241 98.80% 0.40% 0.00% 0.83% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 58.90% 3.30% 4.44% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514453158 C -> T LOC_Os05g24970.1 upstream_gene_variant ; 975.0bp to feature; MODIFIER silent_mutation Average:78.654; most accessible tissue: Minghui63 panicle, score: 94.794 N N N N
vg0514453158 C -> T LOC_Os05g24970.2 upstream_gene_variant ; 847.0bp to feature; MODIFIER silent_mutation Average:78.654; most accessible tissue: Minghui63 panicle, score: 94.794 N N N N
vg0514453158 C -> T LOC_Os05g24970.3 upstream_gene_variant ; 847.0bp to feature; MODIFIER silent_mutation Average:78.654; most accessible tissue: Minghui63 panicle, score: 94.794 N N N N
vg0514453158 C -> T LOC_Os05g24970-LOC_Os05g24980 intergenic_region ; MODIFIER silent_mutation Average:78.654; most accessible tissue: Minghui63 panicle, score: 94.794 N N N N
vg0514453158 C -> DEL N N silent_mutation Average:78.654; most accessible tissue: Minghui63 panicle, score: 94.794 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514453158 4.40E-06 4.40E-06 mr1209_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514453158 NA 7.66E-06 mr1230_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514453158 3.48E-06 3.05E-06 mr1351_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514453158 NA 8.32E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514453158 1.98E-06 1.13E-06 mr1415_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514453158 NA 7.60E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514453158 NA 9.99E-06 mr1447_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514453158 NA 8.47E-06 mr1605_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514453158 9.09E-06 3.82E-06 mr1763_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514453158 NA 9.54E-06 mr1787_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514453158 9.73E-06 4.58E-06 mr1930_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251