\
| Variant ID: vg0514453158 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 14453158 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GACGTCAGCGTCCGATTTACATGTAAAAACTACTTTAAACCGATTTTTCTCTTAAATTACTTATCCAAATCATGATTCGATTGCATCATTAAATTTGTTG[C/T]
AATTAAATTTTCAAAACAAGACCACACATGGATATATTCCGATGAATTTTTTTTAGCTTATTATTGAATTATTTTTAAATGTTGCACGATGTTCCACCAG
CTGGTGGAACATCGTGCAACATTTAAAAATAATTCAATAATAAGCTAAAAAAAATTCATCGGAATATATCCATGTGTGGTCTTGTTTTGAAAATTTAATT[G/A]
CAACAAATTTAATGATGCAATCGAATCATGATTTGGATAAGTAATTTAAGAGAAAAATCGGTTTAAAGTAGTTTTTACATGTAAATCGGACGCTGACGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.50% | 7.30% | 2.71% | 37.45% | NA |
| All Indica | 2759 | 27.60% | 7.80% | 4.35% | 60.31% | NA |
| All Japonica | 1512 | 97.50% | 0.80% | 0.00% | 1.72% | NA |
| Aus | 269 | 37.20% | 42.80% | 1.49% | 18.59% | NA |
| Indica I | 595 | 22.70% | 11.10% | 2.35% | 63.87% | NA |
| Indica II | 465 | 20.90% | 0.20% | 4.95% | 73.98% | NA |
| Indica III | 913 | 31.90% | 11.30% | 5.59% | 51.26% | NA |
| Indica Intermediate | 786 | 30.30% | 5.60% | 4.07% | 60.05% | NA |
| Temperate Japonica | 767 | 97.10% | 0.00% | 0.00% | 2.87% | NA |
| Tropical Japonica | 504 | 97.40% | 2.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 3.30% | 4.44% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0514453158 | C -> T | LOC_Os05g24970.1 | upstream_gene_variant ; 975.0bp to feature; MODIFIER | silent_mutation | Average:78.654; most accessible tissue: Minghui63 panicle, score: 94.794 | N | N | N | N |
| vg0514453158 | C -> T | LOC_Os05g24970.2 | upstream_gene_variant ; 847.0bp to feature; MODIFIER | silent_mutation | Average:78.654; most accessible tissue: Minghui63 panicle, score: 94.794 | N | N | N | N |
| vg0514453158 | C -> T | LOC_Os05g24970.3 | upstream_gene_variant ; 847.0bp to feature; MODIFIER | silent_mutation | Average:78.654; most accessible tissue: Minghui63 panicle, score: 94.794 | N | N | N | N |
| vg0514453158 | C -> T | LOC_Os05g24970-LOC_Os05g24980 | intergenic_region ; MODIFIER | silent_mutation | Average:78.654; most accessible tissue: Minghui63 panicle, score: 94.794 | N | N | N | N |
| vg0514453158 | C -> DEL | N | N | silent_mutation | Average:78.654; most accessible tissue: Minghui63 panicle, score: 94.794 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0514453158 | 4.40E-06 | 4.40E-06 | mr1209_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514453158 | NA | 7.66E-06 | mr1230_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514453158 | 3.48E-06 | 3.05E-06 | mr1351_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514453158 | NA | 8.32E-06 | mr1376_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514453158 | 1.98E-06 | 1.13E-06 | mr1415_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514453158 | NA | 7.60E-06 | mr1431_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514453158 | NA | 9.99E-06 | mr1447_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514453158 | NA | 8.47E-06 | mr1605_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514453158 | 9.09E-06 | 3.82E-06 | mr1763_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514453158 | NA | 9.54E-06 | mr1787_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514453158 | 9.73E-06 | 4.58E-06 | mr1930_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |