| Variant ID: vg0514401778 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 14401778 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 218. )
CATAGGCTTCAACATTGCGACCAATTTGAGTCGAGAAACATCTCTGGATCATGCGTTGATAAGTTGCTCCCGCGTTCTTCAATCCGATAGGCATGGTGAT[A/G]
TAGCAATAGGCTCCAAAGGGCGTGATGAACGAAGTCTTCAAGCAGTCGGATTCCTTCAATCGGATCTGATGATATCCCGAGTAGCAATCCAAAAAACTGA
TCAGTTTTTTGGATTGCTACTCGGGATATCATCAGATCCGATTGAAGGAATCCGACTGCTTGAAGACTTCGTTCATCACGCCCTTTGGAGCCTATTGCTA[T/C]
ATCACCATGCCTATCGGATTGAAGAACGCGGGAGCAACTTATCAACGCATGATCCAGAGATGTTTCTCGACTCAAATTGGTCGCAATGTTGAAGCCTATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.20% | 14.80% | 2.54% | 44.46% | NA |
| All Indica | 2759 | 5.40% | 16.60% | 4.10% | 73.83% | NA |
| All Japonica | 1512 | 97.20% | 0.90% | 0.07% | 1.85% | NA |
| Aus | 269 | 18.60% | 79.20% | 0.74% | 1.49% | NA |
| Indica I | 595 | 5.40% | 20.50% | 2.35% | 71.76% | NA |
| Indica II | 465 | 4.70% | 4.50% | 3.44% | 87.31% | NA |
| Indica III | 913 | 3.70% | 22.90% | 5.37% | 68.02% | NA |
| Indica Intermediate | 786 | 7.90% | 13.60% | 4.33% | 74.17% | NA |
| Temperate Japonica | 767 | 97.00% | 0.00% | 0.13% | 2.87% | NA |
| Tropical Japonica | 504 | 97.20% | 2.20% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.80% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 8.90% | 4.44% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0514401778 | A -> DEL | LOC_Os05g24850.1 | N | frameshift_variant | Average:38.328; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg0514401778 | A -> G | LOC_Os05g24850.1 | synonymous_variant ; p.Tyr141Tyr; LOW | synonymous_codon | Average:38.328; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0514401778 | NA | 7.19E-30 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514401778 | NA | 6.67E-30 | mr1333 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514401778 | NA | 3.78E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514401778 | NA | 6.06E-31 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514401778 | NA | 4.61E-39 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514401778 | 7.92E-06 | 7.62E-32 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514401778 | 1.26E-06 | NA | mr1100_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514401778 | NA | 8.80E-18 | mr1336_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514401778 | NA | 1.05E-38 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |