\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514396497:

Variant ID: vg0514396497 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14396497
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GATTTTAACAGCATCGGGTCACATCATTGTGAGCACATATTGCCAAAGCAAAACGCGCCTAAGTCCCTAGGGATCAACGGGCCACGCTGGTAATAATATT[G/A]
GGCTAAAGTACTGTACAGGCCTAGGCCCATTAGCACTCCCGATACCCTAACAAAACACAGAAGTCCAAGCGACACTTCGTCTTCCCCGCCGAAACTCTCG

Reverse complement sequence

CGAGAGTTTCGGCGGGGAAGACGAAGTGTCGCTTGGACTTCTGTGTTTTGTTAGGGTATCGGGAGTGCTAATGGGCCTAGGCCTGTACAGTACTTTAGCC[C/T]
AATATTATTACCAGCGTGGCCCGTTGATCCCTAGGGACTTAGGCGCGTTTTGCTTTGGCAATATGTGCTCACAATGATGTGACCCGATGCTGTTAAAATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 10.60% 0.06% 0.00% NA
All Indica  2759 90.30% 9.60% 0.11% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 20.10% 79.90% 0.00% 0.00% NA
Indica I  595 88.20% 11.40% 0.34% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 85.00% 14.90% 0.11% 0.00% NA
Indica Intermediate  786 92.40% 7.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514396497 G -> A LOC_Os05g24840.1 upstream_gene_variant ; 275.0bp to feature; MODIFIER silent_mutation Average:51.84; most accessible tissue: Minghui63 flag leaf, score: 69.182 N N N N
vg0514396497 G -> A LOC_Os05g24850.1 downstream_gene_variant ; 3262.0bp to feature; MODIFIER silent_mutation Average:51.84; most accessible tissue: Minghui63 flag leaf, score: 69.182 N N N N
vg0514396497 G -> A LOC_Os05g24820-LOC_Os05g24840 intergenic_region ; MODIFIER silent_mutation Average:51.84; most accessible tissue: Minghui63 flag leaf, score: 69.182 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514396497 NA 6.88E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514396497 NA 1.20E-11 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514396497 1.01E-06 NA mr1973_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251