\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514370755:

Variant ID: vg0514370755 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14370755
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGACTTGTCTATTACTCTTTTTTTTTAAGATTAGGTCCTGCTATTTTGGTGGTGTTGTGCTGTTGTATGAAATACTCATGACTACTGAAATTTTTTTT[C/T]
CTTATGTTCTGCATTGAGTCCATTATAGTGTCGGTGTGTGTGGCAGACTTGTGGCTACATATGTTTCTTTATTTTGGTGTTGCGGTGCATCTGGACGAAC

Reverse complement sequence

GTTCGTCCAGATGCACCGCAACACCAAAATAAAGAAACATATGTAGCCACAAGTCTGCCACACACACCGACACTATAATGGACTCAATGCAGAACATAAG[G/A]
AAAAAAAATTTCAGTAGTCATGAGTATTTCATACAACAGCACAACACCACCAAAATAGCAGGACCTAATCTTAAAAAAAAAGAGTAATAGACAAGTCAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.30% 45.10% 0.17% 0.38% NA
All Indica  2759 89.60% 9.80% 0.14% 0.43% NA
All Japonica  1512 2.70% 97.10% 0.07% 0.13% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 95.50% 4.00% 0.00% 0.50% NA
Indica II  465 96.10% 3.70% 0.00% 0.22% NA
Indica III  913 83.00% 16.50% 0.11% 0.33% NA
Indica Intermediate  786 89.10% 9.90% 0.38% 0.64% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 2.80% 97.00% 0.00% 0.20% NA
Japonica Intermediate  241 1.70% 97.50% 0.41% 0.41% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 46.70% 45.60% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514370755 C -> T LOC_Os05g24790.1 downstream_gene_variant ; 309.0bp to feature; MODIFIER silent_mutation Average:51.549; most accessible tissue: Callus, score: 64.486 N N N N
vg0514370755 C -> T LOC_Os05g24800.1 downstream_gene_variant ; 777.0bp to feature; MODIFIER silent_mutation Average:51.549; most accessible tissue: Callus, score: 64.486 N N N N
vg0514370755 C -> T LOC_Os05g24790-LOC_Os05g24800 intergenic_region ; MODIFIER silent_mutation Average:51.549; most accessible tissue: Callus, score: 64.486 N N N N
vg0514370755 C -> DEL N N silent_mutation Average:51.549; most accessible tissue: Callus, score: 64.486 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514370755 1.91E-06 8.46E-06 mr1252_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755 6.53E-06 NA mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755 NA 2.46E-07 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755 NA 4.32E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755 NA 9.73E-06 mr1415_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755 NA 4.95E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755 NA 9.63E-06 mr1562_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755 9.12E-06 NA mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755 4.92E-06 4.63E-06 mr1876_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755 1.86E-06 NA mr1942_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251