Variant ID: vg0514370755 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 14370755 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 195. )
ATTGACTTGTCTATTACTCTTTTTTTTTAAGATTAGGTCCTGCTATTTTGGTGGTGTTGTGCTGTTGTATGAAATACTCATGACTACTGAAATTTTTTTT[C/T]
CTTATGTTCTGCATTGAGTCCATTATAGTGTCGGTGTGTGTGGCAGACTTGTGGCTACATATGTTTCTTTATTTTGGTGTTGCGGTGCATCTGGACGAAC
GTTCGTCCAGATGCACCGCAACACCAAAATAAAGAAACATATGTAGCCACAAGTCTGCCACACACACCGACACTATAATGGACTCAATGCAGAACATAAG[G/A]
AAAAAAAATTTCAGTAGTCATGAGTATTTCATACAACAGCACAACACCACCAAAATAGCAGGACCTAATCTTAAAAAAAAAGAGTAATAGACAAGTCAAT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 54.30% | 45.10% | 0.17% | 0.38% | NA |
All Indica | 2759 | 89.60% | 9.80% | 0.14% | 0.43% | NA |
All Japonica | 1512 | 2.70% | 97.10% | 0.07% | 0.13% | NA |
Aus | 269 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
Indica I | 595 | 95.50% | 4.00% | 0.00% | 0.50% | NA |
Indica II | 465 | 96.10% | 3.70% | 0.00% | 0.22% | NA |
Indica III | 913 | 83.00% | 16.50% | 0.11% | 0.33% | NA |
Indica Intermediate | 786 | 89.10% | 9.90% | 0.38% | 0.64% | NA |
Temperate Japonica | 767 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 2.80% | 97.00% | 0.00% | 0.20% | NA |
Japonica Intermediate | 241 | 1.70% | 97.50% | 0.41% | 0.41% | NA |
VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 46.70% | 45.60% | 3.33% | 4.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0514370755 | C -> T | LOC_Os05g24790.1 | downstream_gene_variant ; 309.0bp to feature; MODIFIER | silent_mutation | Average:51.549; most accessible tissue: Callus, score: 64.486 | N | N | N | N |
vg0514370755 | C -> T | LOC_Os05g24800.1 | downstream_gene_variant ; 777.0bp to feature; MODIFIER | silent_mutation | Average:51.549; most accessible tissue: Callus, score: 64.486 | N | N | N | N |
vg0514370755 | C -> T | LOC_Os05g24790-LOC_Os05g24800 | intergenic_region ; MODIFIER | silent_mutation | Average:51.549; most accessible tissue: Callus, score: 64.486 | N | N | N | N |
vg0514370755 | C -> DEL | N | N | silent_mutation | Average:51.549; most accessible tissue: Callus, score: 64.486 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0514370755 | 1.91E-06 | 8.46E-06 | mr1252_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514370755 | 6.53E-06 | NA | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514370755 | NA | 2.46E-07 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514370755 | NA | 4.32E-09 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514370755 | NA | 9.73E-06 | mr1415_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514370755 | NA | 4.95E-06 | mr1511_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514370755 | NA | 9.63E-06 | mr1562_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514370755 | 9.12E-06 | NA | mr1828_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514370755 | 4.92E-06 | 4.63E-06 | mr1876_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514370755 | 1.86E-06 | NA | mr1942_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |