Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514370755:

Variant ID: vg0514370755 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 14370755
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

ATTGACTTGTCTATTACTCTTTTTTTTTAAGATTAGGTCCTGCTATTTTGGTGGTGTTGTGCTGTTGTATGAAATACTCATGACTACTGAAATTTTTTTT[C/T]
CTTATGTTCTGCATTGAGTCCATTATAGTGTCGGTGTGTGTGGCAGACTTGTGGCTACATATGTTTCTTTATTTTGGTGTTGCGGTGCATCTGGACGAAC

Reverse complement sequence

GTTCGTCCAGATGCACCGCAACACCAAAATAAAGAAACATATGTAGCCACAAGTCTGCCACACACACCGACACTATAATGGACTCAATGCAGAACATAAG[G/A]
AAAAAAAATTTCAGTAGTCATGAGTATTTCATACAACAGCACAACACCACCAAAATAGCAGGACCTAATCTTAAAAAAAAAGAGTAATAGACAAGTCAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.30%	45.10%	0.17%	0.38%	NA
All Indica	2759	89.60%	9.80%	0.14%	0.43%	NA
All Japonica	1512	2.70%	97.10%	0.07%	0.13%	NA
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	95.50%	4.00%	0.00%	0.50%	NA
Indica II	465	96.10%	3.70%	0.00%	0.22%	NA
Indica III	913	83.00%	16.50%	0.11%	0.33%	NA
Indica Intermediate	786	89.10%	9.90%	0.38%	0.64%	NA
Temperate Japonica	767	3.00%	97.00%	0.00%	0.00%	NA
Tropical Japonica	504	2.80%	97.00%	0.00%	0.20%	NA
Japonica Intermediate	241	1.70%	97.50%	0.41%	0.41%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	46.70%	45.60%	3.33%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0514370755	C -> T	LOC_Os05g24790.1	downstream_gene_variant ; 309.0bp to feature; MODIFIER	silent_mutation	Average:51.549; most accessible tissue: Callus, score: 64.486	N	N	N	N
vg0514370755	C -> T	LOC_Os05g24800.1	downstream_gene_variant ; 777.0bp to feature; MODIFIER	silent_mutation	Average:51.549; most accessible tissue: Callus, score: 64.486	N	N	N	N
vg0514370755	C -> T	LOC_Os05g24790-LOC_Os05g24800	intergenic_region ; MODIFIER	silent_mutation	Average:51.549; most accessible tissue: Callus, score: 64.486	N	N	N	N
vg0514370755	C -> DEL	N	N	silent_mutation	Average:51.549; most accessible tissue: Callus, score: 64.486	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0514370755	1.91E-06	8.46E-06	mr1252_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755	6.53E-06	NA	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755	NA	2.46E-07	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755	NA	4.32E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755	NA	9.73E-06	mr1415_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755	NA	4.95E-06	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755	NA	9.63E-06	mr1562_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755	9.12E-06	NA	mr1828_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755	4.92E-06	4.63E-06	mr1876_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514370755	1.86E-06	NA	mr1942_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251