\
| Variant ID: vg0514347110 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 14347110 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )
CAGTACCTGTAGATTCACCTGTGAAATCCAATCATCTCCAAAACTACTTCGTGAATAAATTCCAAATATCAAAACCAATAATCTCCGATGCCAATTGTTC[G/A]
TTACAGAATAATAATCAAAAACCTTTATTTTACATATTACATGAAAGTTTTTGGATTTTTCAATCGTAAGTTTTTGTGATTTTGAGATGAAAGTTTTAGA
TCTAAAACTTTCATCTCAAAATCACAAAAACTTACGATTGAAAAATCCAAAAACTTTCATGTAATATGTAAAATAAAGGTTTTTGATTATTATTCTGTAA[C/T]
GAACAATTGGCATCGGAGATTATTGGTTTTGATATTTGGAATTTATTCACGAAGTAGTTTTGGAGATGATTGGATTTCACAGGTGAATCTACAGGTACTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.80% | 2.60% | 0.57% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 90.90% | 7.50% | 1.59% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 96.20% | 2.10% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 84.10% | 14.30% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 10.80% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0514347110 | G -> A | LOC_Os05g24740.1 | upstream_gene_variant ; 4628.0bp to feature; MODIFIER | silent_mutation | Average:53.974; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0514347110 | G -> A | LOC_Os05g24750.1 | downstream_gene_variant ; 4092.0bp to feature; MODIFIER | silent_mutation | Average:53.974; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0514347110 | G -> A | LOC_Os05g24740-LOC_Os05g24750 | intergenic_region ; MODIFIER | silent_mutation | Average:53.974; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0514347110 | NA | 3.45E-07 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514347110 | 3.15E-07 | 7.21E-14 | mr1301 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514347110 | 1.10E-06 | 9.43E-13 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514347110 | NA | 1.23E-07 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514347110 | NA | 4.89E-15 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514347110 | NA | 1.48E-13 | mr1951 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514347110 | 3.66E-06 | NA | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514347110 | 5.95E-06 | 3.58E-12 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514347110 | NA | 2.44E-08 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514347110 | NA | 7.03E-18 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514347110 | NA | 3.31E-06 | mr1951_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |