Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0514347110:

Variant ID: vg0514347110 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 14347110
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

CAGTACCTGTAGATTCACCTGTGAAATCCAATCATCTCCAAAACTACTTCGTGAATAAATTCCAAATATCAAAACCAATAATCTCCGATGCCAATTGTTC[G/A]
TTACAGAATAATAATCAAAAACCTTTATTTTACATATTACATGAAAGTTTTTGGATTTTTCAATCGTAAGTTTTTGTGATTTTGAGATGAAAGTTTTAGA

Reverse complement sequence

TCTAAAACTTTCATCTCAAAATCACAAAAACTTACGATTGAAAAATCCAAAAACTTTCATGTAATATGTAAAATAAAGGTTTTTGATTATTATTCTGTAA[C/T]
GAACAATTGGCATCGGAGATTATTGGTTTTGATATTTGGAATTTATTCACGAAGTAGTTTTGGAGATGATTGGATTTCACAGGTGAATCTACAGGTACTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.80%	2.60%	0.57%	0.00%	NA
All Indica	2759	99.80%	0.10%	0.07%	0.00%	NA
All Japonica	1512	90.90%	7.50%	1.59%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.40%	0.25%	0.00%	NA
Temperate Japonica	767	96.20%	2.10%	1.69%	0.00%	NA
Tropical Japonica	504	84.10%	14.30%	1.59%	0.00%	NA
Japonica Intermediate	241	88.00%	10.80%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	3.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0514347110	G -> A	LOC_Os05g24740.1	upstream_gene_variant ; 4628.0bp to feature; MODIFIER	silent_mutation	Average:53.974; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0514347110	G -> A	LOC_Os05g24750.1	downstream_gene_variant ; 4092.0bp to feature; MODIFIER	silent_mutation	Average:53.974; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0514347110	G -> A	LOC_Os05g24740-LOC_Os05g24750	intergenic_region ; MODIFIER	silent_mutation	Average:53.974; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0514347110	NA	3.45E-07	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110	3.15E-07	7.21E-14	mr1301	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110	1.10E-06	9.43E-13	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110	NA	1.23E-07	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110	NA	4.89E-15	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110	NA	1.48E-13	mr1951	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110	3.66E-06	NA	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110	5.95E-06	3.58E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110	NA	2.44E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110	NA	7.03E-18	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110	NA	3.31E-06	mr1951_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251