\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514347110:

Variant ID: vg0514347110 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14347110
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


CAGTACCTGTAGATTCACCTGTGAAATCCAATCATCTCCAAAACTACTTCGTGAATAAATTCCAAATATCAAAACCAATAATCTCCGATGCCAATTGTTC[G/A]
TTACAGAATAATAATCAAAAACCTTTATTTTACATATTACATGAAAGTTTTTGGATTTTTCAATCGTAAGTTTTTGTGATTTTGAGATGAAAGTTTTAGA

Reverse complement sequence

TCTAAAACTTTCATCTCAAAATCACAAAAACTTACGATTGAAAAATCCAAAAACTTTCATGTAATATGTAAAATAAAGGTTTTTGATTATTATTCTGTAA[C/T]
GAACAATTGGCATCGGAGATTATTGGTTTTGATATTTGGAATTTATTCACGAAGTAGTTTTGGAGATGATTGGATTTCACAGGTGAATCTACAGGTACTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.80% 2.60% 0.57% 0.00% NA
All Indica  2759 99.80% 0.10% 0.07% 0.00% NA
All Japonica  1512 90.90% 7.50% 1.59% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.40% 0.25% 0.00% NA
Temperate Japonica  767 96.20% 2.10% 1.69% 0.00% NA
Tropical Japonica  504 84.10% 14.30% 1.59% 0.00% NA
Japonica Intermediate  241 88.00% 10.80% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514347110 G -> A LOC_Os05g24740.1 upstream_gene_variant ; 4628.0bp to feature; MODIFIER silent_mutation Average:53.974; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0514347110 G -> A LOC_Os05g24750.1 downstream_gene_variant ; 4092.0bp to feature; MODIFIER silent_mutation Average:53.974; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0514347110 G -> A LOC_Os05g24740-LOC_Os05g24750 intergenic_region ; MODIFIER silent_mutation Average:53.974; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514347110 NA 3.45E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110 3.15E-07 7.21E-14 mr1301 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110 1.10E-06 9.43E-13 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110 NA 1.23E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110 NA 4.89E-15 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110 NA 1.48E-13 mr1951 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110 3.66E-06 NA mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110 5.95E-06 3.58E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110 NA 2.44E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110 NA 7.03E-18 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514347110 NA 3.31E-06 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251