\
| Variant ID: vg0514329455 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 14329455 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCATCTCTCTCCTTTCCTGGGAATTCGCACCGGCGGAGGTGCGTCTATTTAAGGGAGTTTTGGGGATCCCATTTGAGGTCAGCCTATTCAAAAAACTCTC[C/T]
AGCTTCCAAGCGTCCCTCGTCTTCTTCGCTCCTGCAAAAAAACCATAGCCAACTCGTCTCGGTCCTTTCTCCGGCGATCTCCGGTGGCCATGGATCTCGA
TCGAGATCCATGGCCACCGGAGATCGCCGGAGAAAGGACCGAGACGAGTTGGCTATGGTTTTTTTGCAGGAGCGAAGAAGACGAGGGACGCTTGGAAGCT[G/A]
GAGAGTTTTTTGAATAGGCTGACCTCAAATGGGATCCCCAAAACTCCCTTAAATAGACGCACCTCCGCCGGTGCGAATTCCCAGGAAAGGAGAGAGATGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.10% | 48.40% | 0.23% | 0.25% | NA |
| All Indica | 2759 | 84.50% | 15.10% | 0.22% | 0.22% | NA |
| All Japonica | 1512 | 2.60% | 97.20% | 0.07% | 0.20% | NA |
| Aus | 269 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.60% | 12.80% | 0.34% | 0.34% | NA |
| Indica II | 465 | 95.70% | 4.10% | 0.00% | 0.22% | NA |
| Indica III | 913 | 76.30% | 23.40% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 85.80% | 13.60% | 0.38% | 0.25% | NA |
| Temperate Japonica | 767 | 2.90% | 97.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 2.80% | 97.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 1.20% | 97.90% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 50.00% | 4.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0514329455 | C -> T | LOC_Os05g24720.1 | upstream_gene_variant ; 90.0bp to feature; MODIFIER | silent_mutation | Average:48.154; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| vg0514329455 | C -> T | LOC_Os05g24730.1 | downstream_gene_variant ; 3713.0bp to feature; MODIFIER | silent_mutation | Average:48.154; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| vg0514329455 | C -> T | LOC_Os05g24710-LOC_Os05g24720 | intergenic_region ; MODIFIER | silent_mutation | Average:48.154; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| vg0514329455 | C -> DEL | N | N | silent_mutation | Average:48.154; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0514329455 | NA | 3.21E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514329455 | NA | 8.63E-15 | mr1199 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514329455 | NA | 2.89E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514329455 | NA | 3.94E-15 | mr1329 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514329455 | NA | 3.08E-12 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514329455 | NA | 2.62E-11 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514329455 | NA | 1.04E-07 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514329455 | NA | 6.53E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514329455 | NA | 8.22E-12 | mr1883 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |