\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514329455:

Variant ID: vg0514329455 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14329455
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATCTCTCTCCTTTCCTGGGAATTCGCACCGGCGGAGGTGCGTCTATTTAAGGGAGTTTTGGGGATCCCATTTGAGGTCAGCCTATTCAAAAAACTCTC[C/T]
AGCTTCCAAGCGTCCCTCGTCTTCTTCGCTCCTGCAAAAAAACCATAGCCAACTCGTCTCGGTCCTTTCTCCGGCGATCTCCGGTGGCCATGGATCTCGA

Reverse complement sequence

TCGAGATCCATGGCCACCGGAGATCGCCGGAGAAAGGACCGAGACGAGTTGGCTATGGTTTTTTTGCAGGAGCGAAGAAGACGAGGGACGCTTGGAAGCT[G/A]
GAGAGTTTTTTGAATAGGCTGACCTCAAATGGGATCCCCAAAACTCCCTTAAATAGACGCACCTCCGCCGGTGCGAATTCCCAGGAAAGGAGAGAGATGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 48.40% 0.23% 0.25% NA
All Indica  2759 84.50% 15.10% 0.22% 0.22% NA
All Japonica  1512 2.60% 97.20% 0.07% 0.20% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 86.60% 12.80% 0.34% 0.34% NA
Indica II  465 95.70% 4.10% 0.00% 0.22% NA
Indica III  913 76.30% 23.40% 0.11% 0.11% NA
Indica Intermediate  786 85.80% 13.60% 0.38% 0.25% NA
Temperate Japonica  767 2.90% 97.00% 0.00% 0.13% NA
Tropical Japonica  504 2.80% 97.00% 0.00% 0.20% NA
Japonica Intermediate  241 1.20% 97.90% 0.41% 0.41% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 42.20% 50.00% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514329455 C -> T LOC_Os05g24720.1 upstream_gene_variant ; 90.0bp to feature; MODIFIER silent_mutation Average:48.154; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg0514329455 C -> T LOC_Os05g24730.1 downstream_gene_variant ; 3713.0bp to feature; MODIFIER silent_mutation Average:48.154; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg0514329455 C -> T LOC_Os05g24710-LOC_Os05g24720 intergenic_region ; MODIFIER silent_mutation Average:48.154; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg0514329455 C -> DEL N N silent_mutation Average:48.154; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514329455 NA 3.21E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455 NA 8.63E-15 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455 NA 2.89E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455 NA 3.94E-15 mr1329 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455 NA 3.08E-12 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455 NA 2.62E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455 NA 1.04E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455 NA 6.53E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455 NA 8.22E-12 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251