\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514257018:

Variant ID: vg0514257018 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14257018
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCGACCAGGCCGGCCTTGTGCCGTGCTGTGCCCCTGGCCGCCGCTCCCCTCGGCCGCCCGATCGGCTCGGGCCGATCTGGGCCGTCCACGTGGTGGACG[T/C]
GCCCCCGAGGCCACGTGTGGACTTGGTCCACCGTGCGCCCTCCCCCTTTGACTCGCTGACGTGTGGGGCCCGCTTGCCGGCGCCGCCCCTCCCCTTTGCT

Reverse complement sequence

AGCAAAGGGGAGGGGCGGCGCCGGCAAGCGGGCCCCACACGTCAGCGAGTCAAAGGGGGAGGGCGCACGGTGGACCAAGTCCACACGTGGCCTCGGGGGC[A/G]
CGTCCACCACGTGGACGGCCCAGATCGGCCCGAGCCGATCGGGCGGCCGAGGGGAGCGGCGGCCAGGGGCACAGCACGGCACAAGGCCGGCCTGGTCGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.50% 30.00% 22.81% 0.70% NA
All Indica  2759 21.10% 43.90% 34.29% 0.76% NA
All Japonica  1512 95.60% 1.40% 2.45% 0.60% NA
Aus  269 26.40% 53.90% 19.70% 0.00% NA
Indica I  595 13.10% 41.80% 43.19% 1.85% NA
Indica II  465 16.60% 52.30% 30.75% 0.43% NA
Indica III  913 28.00% 42.40% 29.13% 0.44% NA
Indica Intermediate  786 21.80% 42.10% 35.62% 0.51% NA
Temperate Japonica  767 97.00% 0.30% 1.56% 1.17% NA
Tropical Japonica  504 93.70% 2.40% 3.97% 0.00% NA
Japonica Intermediate  241 95.00% 2.90% 2.07% 0.00% NA
VI/Aromatic  96 64.60% 15.60% 19.79% 0.00% NA
Intermediate  90 43.30% 27.80% 25.56% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514257018 T -> DEL N N silent_mutation Average:86.957; most accessible tissue: Minghui63 panicle, score: 99.936 N N N N
vg0514257018 T -> C LOC_Os05g24654.1 downstream_gene_variant ; 1511.0bp to feature; MODIFIER silent_mutation Average:86.957; most accessible tissue: Minghui63 panicle, score: 99.936 N N N N
vg0514257018 T -> C LOC_Os05g24660.1 downstream_gene_variant ; 4466.0bp to feature; MODIFIER silent_mutation Average:86.957; most accessible tissue: Minghui63 panicle, score: 99.936 N N N N
vg0514257018 T -> C LOC_Os05g24654-LOC_Os05g24660 intergenic_region ; MODIFIER silent_mutation Average:86.957; most accessible tissue: Minghui63 panicle, score: 99.936 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0514257018 T C -0.01 -0.01 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514257018 NA 9.77E-06 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514257018 3.73E-06 2.14E-07 mr1135 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514257018 NA 4.67E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514257018 NA 1.07E-06 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514257018 NA 2.46E-35 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514257018 NA 6.70E-09 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514257018 NA 8.96E-06 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251