\
| Variant ID: vg0514203146 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 14203146 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.23, others allele: 0.00, population size: 209. )
CTGCTCTGCTGGGAAAATGGATATGGAATTTGGAAAACAAAGAAGTTTGGTGGCAAGATATACTTAGGGATAAGTATCTGAGAAAAAAACCCCTCTCTGA[G/A]
GTTAAGAATAAAATGGGGGACTCTCACTTTTGGCAAGGTTTATTGGAGATTAAAAACACCTTTTACAAATTCTGTACTAAGAAACTGGGAGATGGCAAAC
GTTTGCCATCTCCCAGTTTCTTAGTACAGAATTTGTAAAAGGTGTTTTTAATCTCCAATAAACCTTGCCAAAAGTGAGAGTCCCCCATTTTATTCTTAAC[C/T]
TCAGAGAGGGGTTTTTTTCTCAGATACTTATCCCTAAGTATATCTTGCCACCAAACTTCTTTGTTTTCCAAATTCCATATCCATTTTCCCAGCAGAGCAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.50% | 44.20% | 0.21% | 0.02% | NA |
| All Indica | 2759 | 92.00% | 7.90% | 0.11% | 0.04% | NA |
| All Japonica | 1512 | 2.50% | 97.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.70% | 4.10% | 0.00% | 0.22% | NA |
| Indica III | 913 | 88.60% | 11.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 90.60% | 9.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.60% | 97.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 0.00% | 99.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 47.80% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0514203146 | G -> DEL | LOC_Os05g24610.1 | N | frameshift_variant | Average:38.096; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| vg0514203146 | G -> A | LOC_Os05g24610.1 | synonymous_variant ; p.Glu1502Glu; LOW | synonymous_codon | Average:38.096; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0514203146 | NA | 1.95E-06 | mr1071 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514203146 | NA | 3.58E-13 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514203146 | NA | 5.34E-11 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514203146 | NA | 3.69E-25 | mr1537 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514203146 | NA | 8.94E-13 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514203146 | NA | 7.69E-16 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514203146 | NA | 6.65E-11 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514203146 | NA | 1.87E-31 | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514203146 | NA | 6.54E-12 | mr1914 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514203146 | NA | 1.55E-28 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514203146 | NA | 1.08E-26 | mr1270_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514203146 | NA | 8.71E-14 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514203146 | NA | 1.96E-39 | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0514203146 | NA | 4.57E-30 | mr1932_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |