Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0514155166:

Variant ID: vg0514155166 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 14155166
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.56, G: 0.44, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GATTAGATTAGCTTAGACATCTACCACCCTGAAAACTCAGTCAACGGCTTGATTGTCTAGATATTATGTTTCTTTTCATATTTAGTGCTGCATCAGTTAA[T/G]
TTTGATCTACTATGTCGTGCTTAGAACCATAATCTCCAGCCTGCTTCTTTATTGCCAATAAGGGTTTCATCGGGGTTTCAGCCGGTGAGTTATCTGGACG

Reverse complement sequence

CGTCCAGATAACTCACCGGCTGAAACCCCGATGAAACCCTTATTGGCAATAAAGAAGCAGGCTGGAGATTATGGTTCTAAGCACGACATAGTAGATCAAA[A/C]
TTAACTGATGCAGCACTAAATATGAAAAGAAACATAATATCTAGACAATCAAGCCGTTGACTGAGTTTTCAGGGTGGTAGATGTCTAAGCTAATCTAATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.50%	29.10%	10.79%	1.54%	NA
All Indica	2759	38.40%	48.90%	11.71%	0.94%	NA
All Japonica	1512	98.80%	0.50%	0.73%	0.00%	NA
Aus	269	20.80%	1.90%	60.97%	16.36%	NA
Indica I	595	60.70%	30.60%	7.73%	1.01%	NA
Indica II	465	34.00%	63.70%	2.15%	0.22%	NA
Indica III	913	25.20%	52.80%	20.81%	1.20%	NA
Indica Intermediate	786	39.60%	49.60%	9.80%	1.02%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	0.00%	1.98%	0.00%	NA
Japonica Intermediate	241	98.80%	0.80%	0.41%	0.00%	NA
VI/Aromatic	96	93.80%	0.00%	5.21%	1.04%	NA
Intermediate	90	74.40%	15.60%	7.78%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0514155166	T -> DEL	N	N	silent_mutation	Average:43.607; most accessible tissue: Minghui63 flag leaf, score: 75.341	N	N	N	N
vg0514155166	T -> G	LOC_Os05g24530.1	upstream_gene_variant ; 785.0bp to feature; MODIFIER	silent_mutation	Average:43.607; most accessible tissue: Minghui63 flag leaf, score: 75.341	N	N	N	N
vg0514155166	T -> G	LOC_Os05g24520.1	downstream_gene_variant ; 3156.0bp to feature; MODIFIER	silent_mutation	Average:43.607; most accessible tissue: Minghui63 flag leaf, score: 75.341	N	N	N	N
vg0514155166	T -> G	LOC_Os05g24540.1	downstream_gene_variant ; 1192.0bp to feature; MODIFIER	silent_mutation	Average:43.607; most accessible tissue: Minghui63 flag leaf, score: 75.341	N	N	N	N
vg0514155166	T -> G	LOC_Os05g24530-LOC_Os05g24540	intergenic_region ; MODIFIER	silent_mutation	Average:43.607; most accessible tissue: Minghui63 flag leaf, score: 75.341	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0514155166	NA	2.04E-13	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514155166	NA	7.25E-06	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514155166	NA	1.63E-13	mr1170_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514155166	NA	2.36E-07	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514155166	NA	5.14E-07	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514155166	NA	6.67E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251