Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514136632:

Variant ID: vg0514136632 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 14136632
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTACTTATAAACTTTGGGTCTATAAACTATTATTTGAATTCAAATTCAAATTTGAAACGGGTATATAAACTTTAGGTGTATAAATTTTAGATGTATAGAA[A/T]
TACTATATATAAAAAAATATTTGAGTTCAAATTCAAATTTGAATCGGATATATAAACTTTTGACTTATAAACTTTAGGTCTATAAACTTTAAATGTATTG

Reverse complement sequence

CAATACATTTAAAGTTTATAGACCTAAAGTTTATAAGTCAAAAGTTTATATATCCGATTCAAATTTGAATTTGAACTCAAATATTTTTTTATATATAGTA[T/A]
TTCTATACATCTAAAATTTATACACCTAAAGTTTATATACCCGTTTCAAATTTGAATTTGAATTCAAATAATAGTTTATAGACCCAAAGTTTATAAGTAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.00%	1.40%	0.80%	1.78%	NA
All Indica	2759	96.70%	0.00%	0.22%	3.04%	NA
All Japonica	1512	93.50%	4.40%	2.12%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	89.10%	0.00%	0.34%	10.59%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	99.80%	0.00%	0.11%	0.11%	NA
Indica Intermediate	786	97.10%	0.10%	0.25%	2.54%	NA
Temperate Japonica	767	97.90%	1.40%	0.65%	0.00%	NA
Tropical Japonica	504	87.90%	7.30%	4.76%	0.00%	NA
Japonica Intermediate	241	91.30%	7.50%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0514136632	A -> T	LOC_Os05g24490.1	upstream_gene_variant ; 1614.0bp to feature; MODIFIER	silent_mutation	Average:20.068; most accessible tissue: Zhenshan97 flag leaf, score: 27.583	N	N	N	N
vg0514136632	A -> T	LOC_Os05g24500.1	upstream_gene_variant ; 3506.0bp to feature; MODIFIER	silent_mutation	Average:20.068; most accessible tissue: Zhenshan97 flag leaf, score: 27.583	N	N	N	N
vg0514136632	A -> T	LOC_Os05g24490-LOC_Os05g24500	intergenic_region ; MODIFIER	silent_mutation	Average:20.068; most accessible tissue: Zhenshan97 flag leaf, score: 27.583	N	N	N	N
vg0514136632	A -> DEL	N	N	silent_mutation	Average:20.068; most accessible tissue: Zhenshan97 flag leaf, score: 27.583	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0514136632	NA	6.29E-07	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514136632	2.88E-06	NA	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514136632	2.20E-06	6.00E-12	mr1410	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514136632	NA	3.33E-08	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514136632	NA	1.00E-12	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514136632	NA	1.35E-11	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514136632	2.25E-06	NA	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514136632	NA	5.28E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514136632	NA	3.52E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514136632	NA	5.35E-15	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251