Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0514055751:

Variant ID: vg0514055751 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 14055751
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCATTATTTGCAGAATCCATCTCAATCGGCTTCTCAGAAATTGCGATATAAAGCGTTGAAGTATACTTTATTGGACGACGAGCTCTATTATCGTACGATT[G/A]
ATGGGGTGTTGCTTAAATGTTTGAGTGCCGATCAGGCTAAGGTTGCAATCAGTGAGGTTCATGAAGAAATTTGTGGCACTCATCAATCAGCTCATAAGAT

Reverse complement sequence

ATCTTATGAGCTGATTGATGAGTGCCACAAATTTCTTCATGAACCTCACTGATTGCAACCTTAGCCTGATCGGCACTCAAACATTTAAGCAACACCCCAT[C/T]
AATCGTACGATAATAGAGCTCGTCGTCCAATAAAGTATACTTCAACGCTTTATATCGCAATTTCTGAGAAGCCGATTGAGATGGATTCTGCAAATAATGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.00%	8.60%	2.86%	23.47%	NA
All Indica	2759	49.10%	6.60%	4.86%	39.51%	NA
All Japonica	1512	99.20%	0.70%	0.00%	0.07%	NA
Aus	269	18.60%	78.40%	0.37%	2.60%	NA
Indica I	595	79.00%	0.00%	3.87%	17.14%	NA
Indica II	465	39.60%	0.40%	6.02%	53.98%	NA
Indica III	913	34.10%	15.20%	5.26%	45.45%	NA
Indica Intermediate	786	49.50%	5.10%	4.45%	40.97%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	4.40%	0.00%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0514055751	G -> DEL	LOC_Os05g24290.1	N	frameshift_variant	Average:41.519; most accessible tissue: Zhenshan97 young leaf, score: 57.78	N	N	N	N
vg0514055751	G -> A	LOC_Os05g24290.1	missense_variant ; p.Asp863Asn; MODERATE	nonsynonymous_codon ; D863N	Average:41.519; most accessible tissue: Zhenshan97 young leaf, score: 57.78	benign	0.894	DELETERIOUS	0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0514055751	NA	1.96E-07	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	3.46E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	1.91E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	3.31E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	1.48E-06	NA	mr1316	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	1.92E-06	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	8.22E-08	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	9.71E-08	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	1.09E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	6.50E-11	mr1348	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	1.26E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	9.00E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	4.61E-06	mr1438	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	2.05E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	2.57E-08	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	7.62E-13	mr1499	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	5.98E-07	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	3.19E-12	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	2.17E-06	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	2.13E-17	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	6.42E-09	mr1939	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	3.07E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	1.94E-21	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	1.96E-09	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	1.77E-30	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	2.51E-11	mr1610_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514055751	NA	2.00E-26	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251