\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514028600:

Variant ID: vg0514028600 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14028600
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTGTTCTGTTGCGGGGTGCGAAAAACCGCCGTCCCCTCAACGTCTTGTTGTCCGATAAGATCTCATGCTCGTCGCCTAGCCTCCAAGGCGCGCTGTCGT[C/T]
GGTCCTCAGCCTCCTTCGCGACCCGTTCGTGTTCCTGTTGCTCACGCTGCAGCCGGTCTCGCTCTTGTGCTAGTCGCTCCTCCTCCAGCCGGCGACGCTC

Reverse complement sequence

GAGCGTCGCCGGCTGGAGGAGGAGCGACTAGCACAAGAGCGAGACCGGCTGCAGCGTGAGCAACAGGAACACGAACGGGTCGCGAAGGAGGCTGAGGACC[G/A]
ACGACAGCGCGCCTTGGAGGCTAGGCGACGAGCATGAGATCTTATCGGACAACAAGACGTTGAGGGGACGGCGGTTTTTCGCACCCCGCAACAGAACACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 10.80% 1.02% 0.00% NA
All Indica  2759 92.50% 6.70% 0.76% 0.00% NA
All Japonica  1512 91.30% 7.00% 1.65% 0.00% NA
Aus  269 21.20% 78.80% 0.00% 0.00% NA
Indica I  595 97.60% 0.00% 2.35% 0.00% NA
Indica II  465 99.10% 0.60% 0.22% 0.00% NA
Indica III  913 84.70% 15.30% 0.00% 0.00% NA
Indica Intermediate  786 93.90% 5.30% 0.76% 0.00% NA
Temperate Japonica  767 96.90% 1.80% 1.30% 0.00% NA
Tropical Japonica  504 84.90% 13.30% 1.79% 0.00% NA
Japonica Intermediate  241 87.10% 10.40% 2.49% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 93.30% 4.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514028600 C -> T LOC_Os05g24260.1 upstream_gene_variant ; 2430.0bp to feature; MODIFIER silent_mutation Average:59.145; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0514028600 C -> T LOC_Os05g24270.1 upstream_gene_variant ; 4150.0bp to feature; MODIFIER silent_mutation Average:59.145; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0514028600 C -> T LOC_Os05g24250.1 intron_variant ; MODIFIER silent_mutation Average:59.145; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514028600 NA 9.11E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514028600 8.97E-07 NA mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514028600 8.65E-09 NA mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514028600 3.51E-06 7.25E-13 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514028600 NA 2.41E-11 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514028600 NA 8.47E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514028600 1.47E-07 NA mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514028600 5.78E-10 NA mr1410_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514028600 NA 8.92E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514028600 NA 1.88E-12 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514028600 NA 6.27E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514028600 NA 1.10E-14 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251