\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514011016:

Variant ID: vg0514011016 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14011016
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.19, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


GATTTGTTTATCAACAATTAGCTAAAAAGATATGAAATTGCAGAAATCCATTTATGGGTTGAAGCAAGCATCTCGGAGTACGAATATTCGTTTTGACGAA[G/A]
TAGTCAAGGCGTTGGGCTTTGTCAAAAATGAAGAAGAGCCTTGTGTATACAAGAAGATTAGTGGGAGCGCACTGGTGTTTCTAATCCTATATGTAGATGA

Reverse complement sequence

TCATCTACATATAGGATTAGAAACACCAGTGCGCTCCCACTAATCTTCTTGTATACACAAGGCTCTTCTTCATTTTTGACAAAGCCCAACGCCTTGACTA[C/T]
TTCGTCAAAACGAATATTCGTACTCCGAGATGCTTGCTTCAACCCATAAATGGATTTCTGCAATTTCATATCTTTTTAGCTAATTGTTGATAAACAAATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.10% 11.20% 5.50% 11.17% NA
All Indica  2759 60.60% 11.40% 9.10% 18.92% NA
All Japonica  1512 99.30% 0.70% 0.07% 0.00% NA
Aus  269 23.00% 74.70% 1.49% 0.74% NA
Indica I  595 65.50% 18.70% 5.04% 10.76% NA
Indica II  465 55.90% 0.90% 10.32% 32.90% NA
Indica III  913 61.90% 14.30% 11.39% 12.38% NA
Indica Intermediate  786 58.10% 8.70% 8.78% 24.43% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.60% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 86.70% 4.40% 4.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514011016 G -> DEL LOC_Os05g24220.1 N frameshift_variant Average:19.641; most accessible tissue: Callus, score: 27.916 N N N N
vg0514011016 G -> A LOC_Os05g24220.1 missense_variant ; p.Val248Ile; MODERATE nonsynonymous_codon ; V248I Average:19.641; most accessible tissue: Callus, score: 27.916 benign 0.619 TOLERATED 0.17

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514011016 7.87E-06 NA mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 NA 1.15E-06 mr1049_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 NA 8.33E-06 mr1061_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 NA 9.87E-06 mr1205_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 5.49E-06 2.92E-06 mr1206_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 4.16E-06 4.16E-06 mr1209_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 5.68E-06 4.84E-06 mr1243_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 4.01E-06 NA mr1270_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 NA 8.97E-06 mr1305_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 NA 6.88E-06 mr1306_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 1.82E-07 4.04E-07 mr1316_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 6.67E-06 1.32E-09 mr1344_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 5.44E-06 4.34E-06 mr1351_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 NA 4.99E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 7.61E-06 1.66E-06 mr1415_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 8.28E-06 6.83E-06 mr1421_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 NA 5.08E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 5.52E-07 4.45E-07 mr1447_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 NA 5.49E-07 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 NA 5.46E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 NA 7.66E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 2.05E-06 2.24E-06 mr1752_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 4.72E-06 5.18E-07 mr1763_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 NA 2.58E-06 mr1876_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 NA 3.49E-06 mr1930_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514011016 4.19E-06 4.19E-06 mr1981_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251