\
| Variant ID: vg0513969126 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 13969126 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.12, others allele: 0.00, population size: 109. )
GTTACGCGCGACTTATCCGGTTCGGTTACGCGGAGTGGAGATCGAGCGGGCGCCCTGATCAAGCGACCTATCTCTATATAAGCCGAGCCGCCGCCTTCAT[G/T]
CAACATACGCGAAATAAATCTAGGGTTTGCCTCCTACTCTGTGCTGCGCCGTCGCTCGTATACTACTCCATCCCGCTTACCGGCGTGCACCAACGATCGG
CCGATCGTTGGTGCACGCCGGTAAGCGGGATGGAGTAGTATACGAGCGACGGCGCAGCACAGAGTAGGAGGCAAACCCTAGATTTATTTCGCGTATGTTG[C/A]
ATGAAGGCGGCGGCTCGGCTTATATAGAGATAGGTCGCTTGATCAGGGCGCCCGCTCGATCTCCACTCCGCGTAACCGAACCGGATAAGTCGCGCGTAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.50% | 41.80% | 1.18% | 4.46% | NA |
| All Indica | 2759 | 61.10% | 36.50% | 1.27% | 1.12% | NA |
| All Japonica | 1512 | 47.40% | 51.90% | 0.33% | 0.33% | NA |
| Aus | 269 | 14.50% | 17.50% | 3.72% | 64.31% | NA |
| Indica I | 595 | 43.40% | 55.60% | 1.01% | 0.00% | NA |
| Indica II | 465 | 67.50% | 31.60% | 0.86% | 0.00% | NA |
| Indica III | 913 | 71.90% | 24.80% | 1.20% | 2.19% | NA |
| Indica Intermediate | 786 | 58.30% | 38.50% | 1.78% | 1.40% | NA |
| Temperate Japonica | 767 | 78.60% | 20.90% | 0.39% | 0.13% | NA |
| Tropical Japonica | 504 | 9.30% | 89.90% | 0.40% | 0.40% | NA |
| Japonica Intermediate | 241 | 27.80% | 71.40% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 6.20% | 92.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 54.40% | 5.56% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0513969126 | G -> T | LOC_Os05g24190.1 | upstream_gene_variant ; 497.0bp to feature; MODIFIER | silent_mutation | Average:48.211; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 | N | N | N | N |
| vg0513969126 | G -> T | LOC_Os05g24180.1 | downstream_gene_variant ; 4459.0bp to feature; MODIFIER | silent_mutation | Average:48.211; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 | N | N | N | N |
| vg0513969126 | G -> T | LOC_Os05g24180-LOC_Os05g24190 | intergenic_region ; MODIFIER | silent_mutation | Average:48.211; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 | N | N | N | N |
| vg0513969126 | G -> DEL | N | N | silent_mutation | Average:48.211; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0513969126 | NA | 6.42E-07 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513969126 | NA | 5.95E-06 | mr1148_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513969126 | NA | 1.52E-06 | mr1240_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513969126 | NA | 9.72E-06 | mr1256_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513969126 | NA | 1.32E-06 | mr1331_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513969126 | 1.89E-06 | NA | mr1551_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513969126 | 6.94E-06 | 3.66E-07 | mr1551_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513969126 | NA | 3.57E-08 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513969126 | NA | 1.38E-06 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513969126 | NA | 2.40E-06 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |