\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0513969126:

Variant ID: vg0513969126 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 13969126
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.12, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GTTACGCGCGACTTATCCGGTTCGGTTACGCGGAGTGGAGATCGAGCGGGCGCCCTGATCAAGCGACCTATCTCTATATAAGCCGAGCCGCCGCCTTCAT[G/T]
CAACATACGCGAAATAAATCTAGGGTTTGCCTCCTACTCTGTGCTGCGCCGTCGCTCGTATACTACTCCATCCCGCTTACCGGCGTGCACCAACGATCGG

Reverse complement sequence

CCGATCGTTGGTGCACGCCGGTAAGCGGGATGGAGTAGTATACGAGCGACGGCGCAGCACAGAGTAGGAGGCAAACCCTAGATTTATTTCGCGTATGTTG[C/A]
ATGAAGGCGGCGGCTCGGCTTATATAGAGATAGGTCGCTTGATCAGGGCGCCCGCTCGATCTCCACTCCGCGTAACCGAACCGGATAAGTCGCGCGTAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.50% 41.80% 1.18% 4.46% NA
All Indica  2759 61.10% 36.50% 1.27% 1.12% NA
All Japonica  1512 47.40% 51.90% 0.33% 0.33% NA
Aus  269 14.50% 17.50% 3.72% 64.31% NA
Indica I  595 43.40% 55.60% 1.01% 0.00% NA
Indica II  465 67.50% 31.60% 0.86% 0.00% NA
Indica III  913 71.90% 24.80% 1.20% 2.19% NA
Indica Intermediate  786 58.30% 38.50% 1.78% 1.40% NA
Temperate Japonica  767 78.60% 20.90% 0.39% 0.13% NA
Tropical Japonica  504 9.30% 89.90% 0.40% 0.40% NA
Japonica Intermediate  241 27.80% 71.40% 0.00% 0.83% NA
VI/Aromatic  96 6.20% 92.70% 1.04% 0.00% NA
Intermediate  90 37.80% 54.40% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0513969126 G -> T LOC_Os05g24190.1 upstream_gene_variant ; 497.0bp to feature; MODIFIER silent_mutation Average:48.211; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N
vg0513969126 G -> T LOC_Os05g24180.1 downstream_gene_variant ; 4459.0bp to feature; MODIFIER silent_mutation Average:48.211; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N
vg0513969126 G -> T LOC_Os05g24180-LOC_Os05g24190 intergenic_region ; MODIFIER silent_mutation Average:48.211; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N
vg0513969126 G -> DEL N N silent_mutation Average:48.211; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0513969126 NA 6.42E-07 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126 NA 5.95E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126 NA 1.52E-06 mr1240_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126 NA 9.72E-06 mr1256_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126 NA 1.32E-06 mr1331_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126 1.89E-06 NA mr1551_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126 6.94E-06 3.66E-07 mr1551_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126 NA 3.57E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126 NA 1.38E-06 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126 NA 2.40E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251