Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0513969126:

Variant ID: vg0513969126 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 13969126
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.12, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GTTACGCGCGACTTATCCGGTTCGGTTACGCGGAGTGGAGATCGAGCGGGCGCCCTGATCAAGCGACCTATCTCTATATAAGCCGAGCCGCCGCCTTCAT[G/T]
CAACATACGCGAAATAAATCTAGGGTTTGCCTCCTACTCTGTGCTGCGCCGTCGCTCGTATACTACTCCATCCCGCTTACCGGCGTGCACCAACGATCGG

Reverse complement sequence

CCGATCGTTGGTGCACGCCGGTAAGCGGGATGGAGTAGTATACGAGCGACGGCGCAGCACAGAGTAGGAGGCAAACCCTAGATTTATTTCGCGTATGTTG[C/A]
ATGAAGGCGGCGGCTCGGCTTATATAGAGATAGGTCGCTTGATCAGGGCGCCCGCTCGATCTCCACTCCGCGTAACCGAACCGGATAAGTCGCGCGTAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	41.80%	1.18%	4.46%	NA
All Indica	2759	61.10%	36.50%	1.27%	1.12%	NA
All Japonica	1512	47.40%	51.90%	0.33%	0.33%	NA
Aus	269	14.50%	17.50%	3.72%	64.31%	NA
Indica I	595	43.40%	55.60%	1.01%	0.00%	NA
Indica II	465	67.50%	31.60%	0.86%	0.00%	NA
Indica III	913	71.90%	24.80%	1.20%	2.19%	NA
Indica Intermediate	786	58.30%	38.50%	1.78%	1.40%	NA
Temperate Japonica	767	78.60%	20.90%	0.39%	0.13%	NA
Tropical Japonica	504	9.30%	89.90%	0.40%	0.40%	NA
Japonica Intermediate	241	27.80%	71.40%	0.00%	0.83%	NA
VI/Aromatic	96	6.20%	92.70%	1.04%	0.00%	NA
Intermediate	90	37.80%	54.40%	5.56%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0513969126	G -> T	LOC_Os05g24190.1	upstream_gene_variant ; 497.0bp to feature; MODIFIER	silent_mutation	Average:48.211; most accessible tissue: Zhenshan97 flag leaf, score: 75.143	N	N	N	N
vg0513969126	G -> T	LOC_Os05g24180.1	downstream_gene_variant ; 4459.0bp to feature; MODIFIER	silent_mutation	Average:48.211; most accessible tissue: Zhenshan97 flag leaf, score: 75.143	N	N	N	N
vg0513969126	G -> T	LOC_Os05g24180-LOC_Os05g24190	intergenic_region ; MODIFIER	silent_mutation	Average:48.211; most accessible tissue: Zhenshan97 flag leaf, score: 75.143	N	N	N	N
vg0513969126	G -> DEL	N	N	silent_mutation	Average:48.211; most accessible tissue: Zhenshan97 flag leaf, score: 75.143	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0513969126	NA	6.42E-07	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126	NA	5.95E-06	mr1148_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126	NA	1.52E-06	mr1240_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126	NA	9.72E-06	mr1256_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126	NA	1.32E-06	mr1331_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126	1.89E-06	NA	mr1551_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126	6.94E-06	3.66E-07	mr1551_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126	NA	3.57E-08	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126	NA	1.38E-06	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513969126	NA	2.40E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251