\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0513751611:

Variant ID: vg0513751611 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 13751611
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCTTAATGGCATTGAAAGCTTTAGGAATTTCAAAGTTAACATGGTAGTAAGGGAGCCTATTAACTATAAGATGTTGTTCCTAGAACATCATTACACCG[A/T]
CTTTGTAGGCCCTACCCAAGCTACCTCAACAGGCAAAACTATTATGTTCGGTCCATGGTGGAGCAGTTGTGGAGGAACCCTGGTCGAAGCCTGGAGTACT

Reverse complement sequence

AGTACTCCAGGCTTCGACCAGGGTTCCTCCACAACTGCTCCACCATGGACCGAACATAATAGTTTTGCCTGTTGAGGTAGCTTGGGTAGGGCCTACAAAG[T/A]
CGGTGTAATGATGTTCTAGGAACAACATCTTATAGTTAATAGGCTCCCTTACTACCATGTTAACTTTGAAATTCCTAAAGCTTTCAATGCCATTAAGAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 5.80% 1.71% 1.35% NA
All Indica  2759 97.20% 0.30% 0.18% 2.32% NA
All Japonica  1512 77.70% 17.30% 4.96% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.40% 0.50% 0.34% 7.73% NA
Indica II  465 98.70% 0.90% 0.22% 0.22% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 0.10% 0.25% 2.16% NA
Temperate Japonica  767 59.10% 31.60% 9.39% 0.00% NA
Tropical Japonica  504 98.80% 1.00% 0.20% 0.00% NA
Japonica Intermediate  241 92.90% 6.20% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0513751611 A -> T LOC_Os05g23900.1 upstream_gene_variant ; 4914.0bp to feature; MODIFIER silent_mutation Average:34.964; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg0513751611 A -> T LOC_Os05g23910.1 downstream_gene_variant ; 151.0bp to feature; MODIFIER silent_mutation Average:34.964; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg0513751611 A -> T LOC_Os05g23924.1 downstream_gene_variant ; 3916.0bp to feature; MODIFIER silent_mutation Average:34.964; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg0513751611 A -> T LOC_Os05g23924.2 downstream_gene_variant ; 3903.0bp to feature; MODIFIER silent_mutation Average:34.964; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg0513751611 A -> T LOC_Os05g23910-LOC_Os05g23924 intergenic_region ; MODIFIER silent_mutation Average:34.964; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg0513751611 A -> DEL N N silent_mutation Average:34.964; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0513751611 NA 2.18E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611 NA 3.99E-06 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611 NA 3.30E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611 NA 2.79E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611 1.97E-09 1.11E-32 mr1137_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611 NA 1.86E-13 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611 NA 1.39E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611 NA 2.18E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611 NA 7.97E-08 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611 8.64E-07 NA mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611 NA 6.42E-10 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611 NA 6.51E-08 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611 NA 2.87E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611 NA 1.85E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611 NA 1.44E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611 NA 2.06E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251