Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0513751611:

Variant ID: vg0513751611 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 13751611
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCTTAATGGCATTGAAAGCTTTAGGAATTTCAAAGTTAACATGGTAGTAAGGGAGCCTATTAACTATAAGATGTTGTTCCTAGAACATCATTACACCG[A/T]
CTTTGTAGGCCCTACCCAAGCTACCTCAACAGGCAAAACTATTATGTTCGGTCCATGGTGGAGCAGTTGTGGAGGAACCCTGGTCGAAGCCTGGAGTACT

Reverse complement sequence

AGTACTCCAGGCTTCGACCAGGGTTCCTCCACAACTGCTCCACCATGGACCGAACATAATAGTTTTGCCTGTTGAGGTAGCTTGGGTAGGGCCTACAAAG[T/A]
CGGTGTAATGATGTTCTAGGAACAACATCTTATAGTTAATAGGCTCCCTTACTACCATGTTAACTTTGAAATTCCTAAAGCTTTCAATGCCATTAAGAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.10%	5.80%	1.71%	1.35%	NA
All Indica	2759	97.20%	0.30%	0.18%	2.32%	NA
All Japonica	1512	77.70%	17.30%	4.96%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	91.40%	0.50%	0.34%	7.73%	NA
Indica II	465	98.70%	0.90%	0.22%	0.22%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	0.10%	0.25%	2.16%	NA
Temperate Japonica	767	59.10%	31.60%	9.39%	0.00%	NA
Tropical Japonica	504	98.80%	1.00%	0.20%	0.00%	NA
Japonica Intermediate	241	92.90%	6.20%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0513751611	A -> T	LOC_Os05g23900.1	upstream_gene_variant ; 4914.0bp to feature; MODIFIER	silent_mutation	Average:34.964; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N
vg0513751611	A -> T	LOC_Os05g23910.1	downstream_gene_variant ; 151.0bp to feature; MODIFIER	silent_mutation	Average:34.964; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N
vg0513751611	A -> T	LOC_Os05g23924.1	downstream_gene_variant ; 3916.0bp to feature; MODIFIER	silent_mutation	Average:34.964; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N
vg0513751611	A -> T	LOC_Os05g23924.2	downstream_gene_variant ; 3903.0bp to feature; MODIFIER	silent_mutation	Average:34.964; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N
vg0513751611	A -> T	LOC_Os05g23910-LOC_Os05g23924	intergenic_region ; MODIFIER	silent_mutation	Average:34.964; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N
vg0513751611	A -> DEL	N	N	silent_mutation	Average:34.964; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0513751611	NA	2.18E-10	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611	NA	3.99E-06	mr1380	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611	NA	3.30E-09	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611	NA	2.79E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611	1.97E-09	1.11E-32	mr1137_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611	NA	1.86E-13	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611	NA	1.39E-08	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611	NA	2.18E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611	NA	7.97E-08	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611	8.64E-07	NA	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611	NA	6.42E-10	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611	NA	6.51E-08	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611	NA	2.87E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611	NA	1.85E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611	NA	1.44E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513751611	NA	2.06E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251