Variant ID: vg0513751374 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 13751374 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 272. )
CATCTTAGCTATGTTTATCCAATGATGTTGTATAGTTTACCTTATACTTTACTCAAGATTAATAAAAAATAATTTGTGTGTGATTCCAGTGGTTTACCTT[G/A]
TGTTTCCATCTACCTTTGTATGGACAATAATAAAAAGATTATTGTTTGTTTGATAATTCAATAATAAAACATTCATAAGTTGTATCATTTATTTAGCAAT
ATTGCTAAATAAATGATACAACTTATGAATGTTTTATTATTGAATTATCAAACAAACAATAATCTTTTTATTATTGTCCATACAAAGGTAGATGGAAACA[C/T]
AAGGTAAACCACTGGAATCACACACAAATTATTTTTTATTAATCTTGAGTAAAGTATAAGGTAAACTATACAACATCATTGGATAAACATAGCTAAGATG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 95.90% | 0.40% | 2.41% | 1.31% | NA |
All Indica | 2759 | 95.40% | 0.00% | 2.32% | 2.25% | NA |
All Japonica | 1512 | 95.80% | 1.10% | 3.11% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 86.70% | 0.00% | 5.71% | 7.56% | NA |
Indica II | 465 | 98.70% | 0.00% | 0.86% | 0.43% | NA |
Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 94.90% | 0.00% | 3.18% | 1.91% | NA |
Temperate Japonica | 767 | 93.10% | 2.10% | 4.82% | 0.00% | NA |
Tropical Japonica | 504 | 98.80% | 0.00% | 1.19% | 0.00% | NA |
Japonica Intermediate | 241 | 98.30% | 0.00% | 1.66% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 1.10% | 3.33% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0513751374 | G -> DEL | N | N | silent_mutation | Average:28.175; most accessible tissue: Callus, score: 43.277 | N | N | N | N |
vg0513751374 | G -> A | LOC_Os05g23910.1 | 3_prime_UTR_variant ; 228.0bp to feature; MODIFIER | silent_mutation | Average:28.175; most accessible tissue: Callus, score: 43.277 | N | N | N | N |
vg0513751374 | G -> A | LOC_Os05g23900.1 | upstream_gene_variant ; 4677.0bp to feature; MODIFIER | silent_mutation | Average:28.175; most accessible tissue: Callus, score: 43.277 | N | N | N | N |
vg0513751374 | G -> A | LOC_Os05g23924.1 | downstream_gene_variant ; 4153.0bp to feature; MODIFIER | silent_mutation | Average:28.175; most accessible tissue: Callus, score: 43.277 | N | N | N | N |
vg0513751374 | G -> A | LOC_Os05g23924.2 | downstream_gene_variant ; 4140.0bp to feature; MODIFIER | silent_mutation | Average:28.175; most accessible tissue: Callus, score: 43.277 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0513751374 | 3.15E-07 | 3.15E-07 | mr1173_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513751374 | 1.79E-06 | 1.79E-06 | mr1499_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513751374 | 3.46E-06 | 9.77E-07 | mr1546_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513751374 | NA | 7.22E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513751374 | NA | 7.73E-06 | mr1821_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |