\
| Variant ID: vg0513696601 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 13696601 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 263. )
TCACCGAGAAGGCTAATCCCTGCATGCGAATCAAAGAACAGAAGCAAGAACAAGATAGATTGCAACACAATTGCATATGAATGATTAAGCACTCGAATTT[G/A]
GGGTTCCACAAACCGATCTAGCGGCGAAACTGTTCTTAACATATTGATCTAAGCAGAACCCGATTCTAAACGATGACGGCTACTGATTAAGTATGATTAG
CTAATCATACTTAATCAGTAGCCGTCATCGTTTAGAATCGGGTTCTGCTTAGATCAATATGTTAAGAACAGTTTCGCCGCTAGATCGGTTTGTGGAACCC[C/T]
AAATTCGAGTGCTTAATCATTCATATGCAATTGTGTTGCAATCTATCTTGTTCTTGCTTCTGTTCTTTGATTCGCATGCAGGGATTAGCCTTCTCGGTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.40% | 24.60% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 86.60% | 13.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 63.40% | 36.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 19.70% | 80.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.10% | 12.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 37.90% | 61.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.40% | 16.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0513696601 | G -> A | LOC_Os05g23830.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.219; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0513696601 | NA | 9.47E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513696601 | NA | 6.51E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513696601 | NA | 6.97E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513696601 | NA | 7.78E-08 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513696601 | NA | 5.17E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513696601 | NA | 6.00E-06 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513696601 | NA | 2.56E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513696601 | NA | 2.74E-10 | mr1596 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513696601 | NA | 2.74E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513696601 | NA | 3.46E-11 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513696601 | NA | 2.94E-08 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |