\
| Variant ID: vg0513679034 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 13679034 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 263. )
AAACCAATATGGATACAATCCGAATAGTCCTTGTCGTTTTCATGTAGAACTCTATTCATCCTTTCTTATGCGGAACTCCTCCTATATCCGAAGGTTGTTT[C/T]
CGTATAAGACATGGTATGTGGTGGGTCCTGCCGAGATTTAGTCAACTACTATTAGGTATGTGGTATCCATAACCCTGACAGTATTTTACTTTAATTATAT
ATATAATTAAAGTAAAATACTGTCAGGGTTATGGATACCACATACCTAATAGTAGTTGACTAAATCTCGGCAGGACCCACCACATACCATGTCTTATACG[G/A]
AAACAACCTTCGGATATAGGAGGAGTTCCGCATAAGAAAGGATGAATAGAGTTCTACATGAAAACGACAAGGACTATTCGGATTGTATCCATATTGGTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 20.10% | 79.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.80% | 10.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0513679034 | C -> T | LOC_Os05g23810.1 | downstream_gene_variant ; 2387.0bp to feature; MODIFIER | silent_mutation | Average:38.789; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0513679034 | C -> T | LOC_Os05g23800-LOC_Os05g23810 | intergenic_region ; MODIFIER | silent_mutation | Average:38.789; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0513679034 | NA | 6.17E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513679034 | NA | 2.05E-06 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513679034 | NA | 1.08E-17 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513679034 | NA | 8.54E-07 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513679034 | NA | 1.41E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513679034 | NA | 3.51E-09 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513679034 | NA | 4.71E-14 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513679034 | NA | 7.19E-13 | mr1499 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513679034 | NA | 7.73E-07 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513679034 | NA | 5.58E-07 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513679034 | NA | 3.71E-06 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513679034 | NA | 2.37E-09 | mr1939 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513679034 | NA | 2.38E-08 | mr1952 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513679034 | NA | 1.57E-18 | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513679034 | NA | 1.07E-16 | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513679034 | NA | 5.78E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |