Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0513549972:

Variant ID: vg0513549972 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 13549972
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

GGGCAGTTATGATGGTTGTAGCTATGCGAATTGTCCATTTTCCCCCGGAACCGTCATTGGGAATCAATTTGGAGCGTCCACGTGGAGGGCTGACCTGAGC[C/T]
GACGTAGCCAGGGTTTGGCTGAACCTGGGCTAGCCCAGCAGGTCTCCAGCTTCGGCAGGGTGGGTGACAGGTGGGTCCTATTGGTGGTTGTGGCAGTTAA

Reverse complement sequence

TTAACTGCCACAACCACCAATAGGACCCACCTGTCACCCACCCTGCCGAAGCTGGAGACCTGCTGGGCTAGCCCAGGTTCAGCCAAACCCTGGCTACGTC[G/A]
GCTCAGGTCAGCCCTCCACGTGGACGCTCCAAATTGATTCCCAATGACGGTTCCGGGGGAAAATGGACAATTCGCATAGCTACAACCATCATAACTGCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.60%	14.30%	3.17%	0.00%	NA
All Indica	2759	71.70%	23.20%	5.07%	0.00%	NA
All Japonica	1512	98.20%	1.20%	0.60%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	52.40%	35.30%	12.27%	0.00%	NA
Indica II	465	71.60%	24.30%	4.09%	0.00%	NA
Indica III	913	82.50%	16.60%	0.88%	0.00%	NA
Indica Intermediate	786	73.80%	21.10%	5.09%	0.00%	NA
Temperate Japonica	767	97.30%	2.00%	0.78%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	98.80%	0.40%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0513549972	C -> T	LOC_Os05g23620.1	upstream_gene_variant ; 2472.0bp to feature; MODIFIER	silent_mutation	Average:69.706; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0513549972	C -> T	LOC_Os05g23620.2	upstream_gene_variant ; 2472.0bp to feature; MODIFIER	silent_mutation	Average:69.706; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0513549972	C -> T	LOC_Os05g23620.3	upstream_gene_variant ; 2435.0bp to feature; MODIFIER	silent_mutation	Average:69.706; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0513549972	C -> T	LOC_Os05g23620.4	upstream_gene_variant ; 2435.0bp to feature; MODIFIER	silent_mutation	Average:69.706; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0513549972	C -> T	LOC_Os05g23620-LOC_Os05g23640	intergenic_region ; MODIFIER	silent_mutation	Average:69.706; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0513549972	NA	1.36E-10	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972	NA	8.08E-06	mr1707	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972	NA	8.83E-07	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972	NA	3.08E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972	9.17E-06	5.75E-11	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972	NA	2.43E-06	mr1707_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972	5.21E-07	2.05E-15	mr1728_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972	NA	3.81E-07	mr1728_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972	NA	8.02E-06	mr1835_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972	NA	4.00E-09	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251