\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0513549972:

Variant ID: vg0513549972 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 13549972
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


GGGCAGTTATGATGGTTGTAGCTATGCGAATTGTCCATTTTCCCCCGGAACCGTCATTGGGAATCAATTTGGAGCGTCCACGTGGAGGGCTGACCTGAGC[C/T]
GACGTAGCCAGGGTTTGGCTGAACCTGGGCTAGCCCAGCAGGTCTCCAGCTTCGGCAGGGTGGGTGACAGGTGGGTCCTATTGGTGGTTGTGGCAGTTAA

Reverse complement sequence

TTAACTGCCACAACCACCAATAGGACCCACCTGTCACCCACCCTGCCGAAGCTGGAGACCTGCTGGGCTAGCCCAGGTTCAGCCAAACCCTGGCTACGTC[G/A]
GCTCAGGTCAGCCCTCCACGTGGACGCTCCAAATTGATTCCCAATGACGGTTCCGGGGGAAAATGGACAATTCGCATAGCTACAACCATCATAACTGCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 14.30% 3.17% 0.00% NA
All Indica  2759 71.70% 23.20% 5.07% 0.00% NA
All Japonica  1512 98.20% 1.20% 0.60% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 52.40% 35.30% 12.27% 0.00% NA
Indica II  465 71.60% 24.30% 4.09% 0.00% NA
Indica III  913 82.50% 16.60% 0.88% 0.00% NA
Indica Intermediate  786 73.80% 21.10% 5.09% 0.00% NA
Temperate Japonica  767 97.30% 2.00% 0.78% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 0.40% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0513549972 C -> T LOC_Os05g23620.1 upstream_gene_variant ; 2472.0bp to feature; MODIFIER silent_mutation Average:69.706; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N
vg0513549972 C -> T LOC_Os05g23620.2 upstream_gene_variant ; 2472.0bp to feature; MODIFIER silent_mutation Average:69.706; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N
vg0513549972 C -> T LOC_Os05g23620.3 upstream_gene_variant ; 2435.0bp to feature; MODIFIER silent_mutation Average:69.706; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N
vg0513549972 C -> T LOC_Os05g23620.4 upstream_gene_variant ; 2435.0bp to feature; MODIFIER silent_mutation Average:69.706; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N
vg0513549972 C -> T LOC_Os05g23620-LOC_Os05g23640 intergenic_region ; MODIFIER silent_mutation Average:69.706; most accessible tissue: Minghui63 young leaf, score: 76.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0513549972 NA 1.36E-10 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972 NA 8.08E-06 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972 NA 8.83E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972 NA 3.08E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972 9.17E-06 5.75E-11 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972 NA 2.43E-06 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972 5.21E-07 2.05E-15 mr1728_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972 NA 3.81E-07 mr1728_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972 NA 8.02E-06 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549972 NA 4.00E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251