\
| Variant ID: vg0513549972 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 13549972 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )
GGGCAGTTATGATGGTTGTAGCTATGCGAATTGTCCATTTTCCCCCGGAACCGTCATTGGGAATCAATTTGGAGCGTCCACGTGGAGGGCTGACCTGAGC[C/T]
GACGTAGCCAGGGTTTGGCTGAACCTGGGCTAGCCCAGCAGGTCTCCAGCTTCGGCAGGGTGGGTGACAGGTGGGTCCTATTGGTGGTTGTGGCAGTTAA
TTAACTGCCACAACCACCAATAGGACCCACCTGTCACCCACCCTGCCGAAGCTGGAGACCTGCTGGGCTAGCCCAGGTTCAGCCAAACCCTGGCTACGTC[G/A]
GCTCAGGTCAGCCCTCCACGTGGACGCTCCAAATTGATTCCCAATGACGGTTCCGGGGGAAAATGGACAATTCGCATAGCTACAACCATCATAACTGCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.60% | 14.30% | 3.17% | 0.00% | NA |
| All Indica | 2759 | 71.70% | 23.20% | 5.07% | 0.00% | NA |
| All Japonica | 1512 | 98.20% | 1.20% | 0.60% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 52.40% | 35.30% | 12.27% | 0.00% | NA |
| Indica II | 465 | 71.60% | 24.30% | 4.09% | 0.00% | NA |
| Indica III | 913 | 82.50% | 16.60% | 0.88% | 0.00% | NA |
| Indica Intermediate | 786 | 73.80% | 21.10% | 5.09% | 0.00% | NA |
| Temperate Japonica | 767 | 97.30% | 2.00% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0513549972 | C -> T | LOC_Os05g23620.1 | upstream_gene_variant ; 2472.0bp to feature; MODIFIER | silent_mutation | Average:69.706; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0513549972 | C -> T | LOC_Os05g23620.2 | upstream_gene_variant ; 2472.0bp to feature; MODIFIER | silent_mutation | Average:69.706; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0513549972 | C -> T | LOC_Os05g23620.3 | upstream_gene_variant ; 2435.0bp to feature; MODIFIER | silent_mutation | Average:69.706; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0513549972 | C -> T | LOC_Os05g23620.4 | upstream_gene_variant ; 2435.0bp to feature; MODIFIER | silent_mutation | Average:69.706; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| vg0513549972 | C -> T | LOC_Os05g23620-LOC_Os05g23640 | intergenic_region ; MODIFIER | silent_mutation | Average:69.706; most accessible tissue: Minghui63 young leaf, score: 76.82 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0513549972 | NA | 1.36E-10 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549972 | NA | 8.08E-06 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549972 | NA | 8.83E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549972 | NA | 3.08E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549972 | 9.17E-06 | 5.75E-11 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549972 | NA | 2.43E-06 | mr1707_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549972 | 5.21E-07 | 2.05E-15 | mr1728_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549972 | NA | 3.81E-07 | mr1728_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549972 | NA | 8.02E-06 | mr1835_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549972 | NA | 4.00E-09 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |