\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0513549188:

Variant ID: vg0513549188 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 13549188
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTGGTATTTCTTAACGACATTACTACAAATATTCATTCCCAGCAATGGCGCATGAATAATCCTGGTATATATGTATGGTCAAAGAAGTAATCCGCAAG[C/T]
GCACGGATATACCATTGTAGCATTTCACCCAGAAGTATACAATCATGTGGCTAATACCCCCTAACAGTGCCCTCCTGGTGTTTCGAGAGACCATCCTGGG

Reverse complement sequence

CCCAGGATGGTCTCTCGAAACACCAGGAGGGCACTGTTAGGGGGTATTAGCCACATGATTGTATACTTCTGGGTGAAATGCTACAATGGTATATCCGTGC[G/A]
CTTGCGGATTACTTCTTTGACCATACATATATACCAGGATTATTCATGCGCCATTGCTGGGAATGAATATTTGTAGTAATGTCGTTAAGAAATACCAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.20% 1.60% 0.25% 0.00% NA
All Indica  2759 96.90% 2.70% 0.43% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 90.30% 8.40% 1.34% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.80% 2.80% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0513549188 C -> T LOC_Os05g23620.1 upstream_gene_variant ; 1688.0bp to feature; MODIFIER silent_mutation Average:68.039; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg0513549188 C -> T LOC_Os05g23620.2 upstream_gene_variant ; 1688.0bp to feature; MODIFIER silent_mutation Average:68.039; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg0513549188 C -> T LOC_Os05g23620.3 upstream_gene_variant ; 1651.0bp to feature; MODIFIER silent_mutation Average:68.039; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg0513549188 C -> T LOC_Os05g23620.4 upstream_gene_variant ; 1651.0bp to feature; MODIFIER silent_mutation Average:68.039; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg0513549188 C -> T LOC_Os05g23620-LOC_Os05g23640 intergenic_region ; MODIFIER silent_mutation Average:68.039; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0513549188 NA 9.85E-06 mr1164_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549188 8.49E-06 2.12E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549188 NA 2.05E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549188 3.11E-06 1.72E-06 mr1452_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549188 NA 5.70E-06 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549188 8.27E-06 2.39E-07 mr1749_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549188 1.80E-06 1.80E-06 mr1821_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549188 NA 6.92E-08 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513549188 NA 6.68E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251