\
| Variant ID: vg0513549188 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 13549188 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 327. )
AGTTGGTATTTCTTAACGACATTACTACAAATATTCATTCCCAGCAATGGCGCATGAATAATCCTGGTATATATGTATGGTCAAAGAAGTAATCCGCAAG[C/T]
GCACGGATATACCATTGTAGCATTTCACCCAGAAGTATACAATCATGTGGCTAATACCCCCTAACAGTGCCCTCCTGGTGTTTCGAGAGACCATCCTGGG
CCCAGGATGGTCTCTCGAAACACCAGGAGGGCACTGTTAGGGGGTATTAGCCACATGATTGTATACTTCTGGGTGAAATGCTACAATGGTATATCCGTGC[G/A]
CTTGCGGATTACTTCTTTGACCATACATATATACCAGGATTATTCATGCGCCATTGCTGGGAATGAATATTTGTAGTAATGTCGTTAAGAAATACCAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.20% | 1.60% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 96.90% | 2.70% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.30% | 8.40% | 1.34% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 2.80% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0513549188 | C -> T | LOC_Os05g23620.1 | upstream_gene_variant ; 1688.0bp to feature; MODIFIER | silent_mutation | Average:68.039; most accessible tissue: Zhenshan97 young leaf, score: 78.044 | N | N | N | N |
| vg0513549188 | C -> T | LOC_Os05g23620.2 | upstream_gene_variant ; 1688.0bp to feature; MODIFIER | silent_mutation | Average:68.039; most accessible tissue: Zhenshan97 young leaf, score: 78.044 | N | N | N | N |
| vg0513549188 | C -> T | LOC_Os05g23620.3 | upstream_gene_variant ; 1651.0bp to feature; MODIFIER | silent_mutation | Average:68.039; most accessible tissue: Zhenshan97 young leaf, score: 78.044 | N | N | N | N |
| vg0513549188 | C -> T | LOC_Os05g23620.4 | upstream_gene_variant ; 1651.0bp to feature; MODIFIER | silent_mutation | Average:68.039; most accessible tissue: Zhenshan97 young leaf, score: 78.044 | N | N | N | N |
| vg0513549188 | C -> T | LOC_Os05g23620-LOC_Os05g23640 | intergenic_region ; MODIFIER | silent_mutation | Average:68.039; most accessible tissue: Zhenshan97 young leaf, score: 78.044 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0513549188 | NA | 9.85E-06 | mr1164_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549188 | 8.49E-06 | 2.12E-06 | mr1349_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549188 | NA | 2.05E-06 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549188 | 3.11E-06 | 1.72E-06 | mr1452_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549188 | NA | 5.70E-06 | mr1576_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549188 | 8.27E-06 | 2.39E-07 | mr1749_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549188 | 1.80E-06 | 1.80E-06 | mr1821_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549188 | NA | 6.92E-08 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513549188 | NA | 6.68E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |