\
| Variant ID: vg0513460624 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 13460624 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTATTATTCGGAATAAATCAAAAGCATAGAGATAAGATAAATTTATTTTCTGCTCTTACAATTGCAAAAGTACCCGAGTAGTAAATTTTGATTCGTGAAA[C/T]
TTTGTTCCATTAATGACGAACTCATGTCACTCATATGCATGTTTGGGAAGTGCCTAAACCAACTCCCGATGCTTGGGGGCTATGACTAGTCGGGCAGAGT
ACTCTGCCCGACTAGTCATAGCCCCCAAGCATCGGGAGTTGGTTTAGGCACTTCCCAAACATGCATATGAGTGACATGAGTTCGTCATTAATGGAACAAA[G/A]
TTTCACGAATCAAAATTTACTACTCGGGTACTTTTGCAATTGTAAGAGCAGAAAATAAATTTATCTTATCTCTATGCTTTTGATTTATTCCGAATAATAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.30% | 2.40% | 4.36% | 0.00% | NA |
| All Indica | 2759 | 95.70% | 0.30% | 3.95% | 0.00% | NA |
| All Japonica | 1512 | 87.60% | 6.70% | 5.69% | 0.00% | NA |
| Aus | 269 | 97.80% | 0.00% | 2.23% | 0.00% | NA |
| Indica I | 595 | 91.60% | 0.70% | 7.73% | 0.00% | NA |
| Indica II | 465 | 95.30% | 0.00% | 4.73% | 0.00% | NA |
| Indica III | 913 | 98.90% | 0.10% | 0.99% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 0.50% | 4.07% | 0.00% | NA |
| Temperate Japonica | 767 | 82.90% | 9.90% | 7.17% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 1.20% | 2.78% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 7.90% | 7.05% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0513460624 | C -> T | LOC_Os05g23500-LOC_Os05g23520 | intergenic_region ; MODIFIER | silent_mutation | Average:38.945; most accessible tissue: Minghui63 flag leaf, score: 71.577 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0513460624 | NA | 8.50E-07 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513460624 | NA | 6.02E-06 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513460624 | 2.42E-06 | NA | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513460624 | NA | 5.05E-08 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513460624 | 2.72E-06 | 1.20E-07 | mr1697 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0513460624 | 3.40E-06 | 1.56E-09 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |