\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0513235168:

Variant ID: vg0513235168 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 13235168
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TATGCACCTTTTTAAATTAGTAGAACAGTATATACCTTTTTTAAGTTAGTAGCGGTATGTACCTTTTTAAATTATTAGAACAGTATATACCTTTTAAGTT[A/T]
GTAGCGGTATATATACTTCTTTTAAAGTTAGTATCAGTATATACTGTTTTTTTTTCTTAAGGTAGTGGCAGTATATACTTCTAAGTTAGTAGGGAGGATA

Reverse complement sequence

TATCCTCCCTACTAACTTAGAAGTATATACTGCCACTACCTTAAGAAAAAAAAACAGTATATACTGATACTAACTTTAAAAGAAGTATATATACCGCTAC[T/A]
AACTTAAAAGGTATATACTGTTCTAATAATTTAAAAAGGTACATACCGCTACTAACTTAAAAAAGGTATATACTGTTCTACTAATTTAAAAAGGTGCATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.40% 3.30% 0.32% 0.00% NA
All Indica  2759 93.80% 5.60% 0.54% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 86.70% 12.60% 0.67% 0.00% NA
Indica II  465 96.80% 2.60% 0.65% 0.00% NA
Indica III  913 96.80% 2.80% 0.33% 0.00% NA
Indica Intermediate  786 94.00% 5.30% 0.64% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0513235168 A -> T LOC_Os05g23194.1 upstream_gene_variant ; 4453.0bp to feature; MODIFIER silent_mutation Average:43.62; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N
vg0513235168 A -> T LOC_Os05g23200.1 downstream_gene_variant ; 238.0bp to feature; MODIFIER silent_mutation Average:43.62; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N
vg0513235168 A -> T LOC_Os05g23210.1 downstream_gene_variant ; 4414.0bp to feature; MODIFIER silent_mutation Average:43.62; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N
vg0513235168 A -> T LOC_Os05g23194-LOC_Os05g23200 intergenic_region ; MODIFIER silent_mutation Average:43.62; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0513235168 NA 1.28E-06 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513235168 1.91E-06 NA mr1397_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513235168 1.02E-06 8.45E-06 mr1397_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513235168 NA 8.56E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513235168 NA 9.11E-06 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251