\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0512839822:

Variant ID: vg0512839822 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 12839822
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGTATACGGACACACATTTAAAGCACTAGTCAGCGTGCACCTGTAAGGCACGTCGATACCTATTGAATGGAATCAAATTTGAAAAAGAGTATTGAGCCT[C/T]
GGTACTAATAAAATATATGATTTTTCATACAAACACAGTGGTGATAAACCGAGAAAAAAAACATGTTTCGAAGATCCAAATACCACGTTACTATGTACTC

Reverse complement sequence

GAGTACATAGTAACGTGGTATTTGGATCTTCGAAACATGTTTTTTTTCTCGGTTTATCACCACTGTGTTTGTATGAAAAATCATATATTTTATTAGTACC[G/A]
AGGCTCAATACTCTTTTTCAAATTTGATTCCATTCAATAGGTATCGACGTGCCTTACAGGTGCACGCTGACTAGTGCTTTAAATGTGTGTCCGTATACGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.70% 12.90% 5.44% 0.00% NA
All Indica  2759 92.50% 2.20% 5.26% 0.00% NA
All Japonica  1512 57.30% 35.70% 6.94% 0.00% NA
Aus  269 98.50% 0.70% 0.74% 0.00% NA
Indica I  595 82.20% 4.70% 13.11% 0.00% NA
Indica II  465 91.40% 4.30% 4.30% 0.00% NA
Indica III  913 99.70% 0.10% 0.22% 0.00% NA
Indica Intermediate  786 92.70% 1.50% 5.73% 0.00% NA
Temperate Japonica  767 28.90% 61.40% 9.65% 0.00% NA
Tropical Japonica  504 91.10% 5.80% 3.17% 0.00% NA
Japonica Intermediate  241 77.20% 16.60% 6.22% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 7.80% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0512839822 C -> T LOC_Os05g22614.1 upstream_gene_variant ; 427.0bp to feature; MODIFIER silent_mutation Average:87.494; most accessible tissue: Callus, score: 95.535 N N N N
vg0512839822 C -> T LOC_Os05g22630.1 upstream_gene_variant ; 4496.0bp to feature; MODIFIER silent_mutation Average:87.494; most accessible tissue: Callus, score: 95.535 N N N N
vg0512839822 C -> T LOC_Os05g22614.3 upstream_gene_variant ; 441.0bp to feature; MODIFIER silent_mutation Average:87.494; most accessible tissue: Callus, score: 95.535 N N N N
vg0512839822 C -> T LOC_Os05g22614.4 upstream_gene_variant ; 402.0bp to feature; MODIFIER silent_mutation Average:87.494; most accessible tissue: Callus, score: 95.535 N N N N
vg0512839822 C -> T LOC_Os05g22614-LOC_Os05g22630 intergenic_region ; MODIFIER silent_mutation Average:87.494; most accessible tissue: Callus, score: 95.535 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0512839822 C T -0.02 -0.02 -0.03 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0512839822 NA 6.87E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512839822 6.90E-06 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512839822 NA 1.52E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512839822 NA 5.57E-09 mr1548 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512839822 NA 6.84E-07 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512839822 NA 6.19E-07 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512839822 NA 1.12E-09 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251