\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0512828870:

Variant ID: vg0512828870 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 12828870
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGGAGCAAAATATATTGCCACTGATTATTTATTGTATTGTGGCACTAGGCAGGATTCAGCTTGTGAGTAAAAAAATTGTATAATTACATTTGTACCAA[G/C]
AAAGCCACGTGTTTATGATAAAAAATTTAGCATGCTGTTAGTCTAGATATGTTTTATATCTCCTAAATTTATGCCTTGTCCAGGGCAAGTTACTGGCTTT

Reverse complement sequence

AAAGCCAGTAACTTGCCCTGGACAAGGCATAAATTTAGGAGATATAAAACATATCTAGACTAACAGCATGCTAAATTTTTTATCATAAACACGTGGCTTT[C/G]
TTGGTACAAATGTAATTATACAATTTTTTTACTCACAAGCTGAATCCTGCCTAGTGCCACAATACAATAAATAATCAGTGGCAATATATTTTGCTCCTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 7.70% 2.35% 0.00% NA
All Indica  2759 84.30% 12.20% 3.44% 0.00% NA
All Japonica  1512 97.90% 1.30% 0.86% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 73.30% 17.80% 8.91% 0.00% NA
Indica II  465 76.80% 19.10% 4.09% 0.00% NA
Indica III  913 94.60% 4.80% 0.55% 0.00% NA
Indica Intermediate  786 85.20% 12.50% 2.29% 0.00% NA
Temperate Japonica  767 97.10% 2.20% 0.65% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 96.70% 0.40% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 11.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0512828870 G -> C LOC_Os05g22590.1 upstream_gene_variant ; 3893.0bp to feature; MODIFIER silent_mutation Average:50.392; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg0512828870 G -> C LOC_Os05g22614.1 downstream_gene_variant ; 4589.0bp to feature; MODIFIER silent_mutation Average:50.392; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg0512828870 G -> C LOC_Os05g22614.3 downstream_gene_variant ; 4589.0bp to feature; MODIFIER silent_mutation Average:50.392; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg0512828870 G -> C LOC_Os05g22600.1 intron_variant ; MODIFIER silent_mutation Average:50.392; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0512828870 1.89E-06 NA mr1593_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512828870 1.08E-06 NA mr1593_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251