\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0512704119:

Variant ID: vg0512704119 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 12704119
Reference Allele: GAlternative Allele: C,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTGATCGCATTAACACTCCTTGGAGTTACCTCGATCCCCCTCTCATGAACAAGAAATCCCAAAAACTGGCCAGCCGATACACCAAAAGCACATTTTGT[G/C,T]
GGATTCATCTTCAGGCCATATTTTCTGGTTCTCTCGAAAACCTTCCTCAAATCAGCTATATGGTCCTTTATTTCTTTAGACTTAACAACCACATCATCAA

Reverse complement sequence

TTGATGATGTGGTTGTTAAGTCTAAAGAAATAAAGGACCATATAGCTGATTTGAGGAAGGTTTTCGAGAGAACCAGAAAATATGGCCTGAAGATGAATCC[C/G,A]
ACAAAATGTGCTTTTGGTGTATCGGCTGGCCAGTTTTTGGGATTTCTTGTTCATGAGAGGGGGATCGAGGTAACTCCAAGGAGTGTTAATGCGATCAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 13.60% 14.81% 7.36% T: 0.02%
All Indica  2759 72.70% 3.40% 15.59% 8.23% T: 0.04%
All Japonica  1512 54.00% 35.50% 10.25% 0.20% NA
Aus  269 22.70% 0.40% 35.69% 41.26% NA
Indica I  595 56.30% 8.10% 34.96% 0.67% NA
Indica II  465 80.00% 4.90% 13.98% 1.08% NA
Indica III  913 79.80% 0.30% 3.94% 15.77% T: 0.11%
Indica Intermediate  786 72.60% 2.50% 15.39% 9.41% NA
Temperate Japonica  767 25.60% 61.00% 13.43% 0.00% NA
Tropical Japonica  504 88.10% 6.20% 5.16% 0.60% NA
Japonica Intermediate  241 73.40% 15.80% 10.79% 0.00% NA
VI/Aromatic  96 89.60% 0.00% 10.42% 0.00% NA
Intermediate  90 70.00% 12.20% 10.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0512704119 G -> T LOC_Os05g22390.1 synonymous_variant ; p.Pro821Pro; LOW synonymous_codon Average:26.853; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg0512704119 G -> DEL LOC_Os05g22390.1 N frameshift_variant Average:26.853; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg0512704119 G -> C LOC_Os05g22390.1 synonymous_variant ; p.Pro821Pro; LOW synonymous_codon Average:26.853; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0512704119 NA 1.47E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 1.52E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 6.10E-11 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 3.14E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 2.09E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 7.68E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 8.80E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 6.61E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 7.12E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 1.06E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 1.02E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 9.59E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 8.88E-08 NA mr1627 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 6.15E-07 7.19E-13 mr1627 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 2.13E-06 mr1865 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 8.48E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 5.26E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 1.76E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 2.65E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 1.37E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 1.13E-12 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 1.36E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512704119 NA 1.29E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251