\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0512386404:

Variant ID: vg0512386404 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 12386404
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


GTAACCATAATATACCAAGAGTATTTCTGCACTATTGCTAGGAATTATATTTCTAGTAATGTCGTTAACAAATACCGACAAGCATTTCTGGCGCCGTTGC[C/T]
GGGGAAGATACATAATAGAGATTACCTGAACTAATATTTTGTATTTACCCTCTGTATAATCATTTTCCTTTACAGGCTAACCTTGGTTGTTTTCACTTTT

Reverse complement sequence

AAAAGTGAAAACAACCAAGGTTAGCCTGTAAAGGAAAATGATTATACAGAGGGTAAATACAAAATATTAGTTCAGGTAATCTCTATTATGTATCTTCCCC[G/A]
GCAACGGCGCCAGAAATGCTTGTCGGTATTTGTTAACGACATTACTAGAAATATAATTCCTAGCAATAGTGCAGAAATACTCTTGGTATATTATGGTTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.90% 2.20% 1.82% 0.00% NA
All Indica  2759 98.00% 0.10% 1.81% 0.00% NA
All Japonica  1512 91.10% 6.70% 2.12% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 95.60% 0.00% 4.37% 0.00% NA
Indica II  465 99.60% 0.00% 0.43% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 96.80% 0.50% 2.67% 0.00% NA
Temperate Japonica  767 96.70% 1.30% 1.96% 0.00% NA
Tropical Japonica  504 84.70% 13.30% 1.98% 0.00% NA
Japonica Intermediate  241 86.70% 10.40% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 0.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0512386404 C -> T LOC_Os05g21050.1 upstream_gene_variant ; 1234.0bp to feature; MODIFIER silent_mutation Average:50.936; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg0512386404 C -> T LOC_Os05g21060.1 upstream_gene_variant ; 1149.0bp to feature; MODIFIER silent_mutation Average:50.936; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg0512386404 C -> T LOC_Os05g21050-LOC_Os05g21060 intergenic_region ; MODIFIER silent_mutation Average:50.936; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0512386404 NA 5.13E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404 NA 1.12E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404 4.27E-06 NA mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404 NA 1.26E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404 NA 9.34E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404 NA 3.29E-15 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404 NA 6.38E-13 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404 2.40E-07 NA mr1301_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404 NA 7.36E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404 NA 8.28E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404 NA 3.84E-16 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251