Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0512386404:

Variant ID: vg0512386404 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 12386404
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

GTAACCATAATATACCAAGAGTATTTCTGCACTATTGCTAGGAATTATATTTCTAGTAATGTCGTTAACAAATACCGACAAGCATTTCTGGCGCCGTTGC[C/T]
GGGGAAGATACATAATAGAGATTACCTGAACTAATATTTTGTATTTACCCTCTGTATAATCATTTTCCTTTACAGGCTAACCTTGGTTGTTTTCACTTTT

Reverse complement sequence

AAAAGTGAAAACAACCAAGGTTAGCCTGTAAAGGAAAATGATTATACAGAGGGTAAATACAAAATATTAGTTCAGGTAATCTCTATTATGTATCTTCCCC[G/A]
GCAACGGCGCCAGAAATGCTTGTCGGTATTTGTTAACGACATTACTAGAAATATAATTCCTAGCAATAGTGCAGAAATACTCTTGGTATATTATGGTTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.90%	2.20%	1.82%	0.00%	NA
All Indica	2759	98.00%	0.10%	1.81%	0.00%	NA
All Japonica	1512	91.10%	6.70%	2.12%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	95.60%	0.00%	4.37%	0.00%	NA
Indica II	465	99.60%	0.00%	0.43%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	96.80%	0.50%	2.67%	0.00%	NA
Temperate Japonica	767	96.70%	1.30%	1.96%	0.00%	NA
Tropical Japonica	504	84.70%	13.30%	1.98%	0.00%	NA
Japonica Intermediate	241	86.70%	10.40%	2.90%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	0.00%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0512386404	C -> T	LOC_Os05g21050.1	upstream_gene_variant ; 1234.0bp to feature; MODIFIER	silent_mutation	Average:50.936; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N
vg0512386404	C -> T	LOC_Os05g21060.1	upstream_gene_variant ; 1149.0bp to feature; MODIFIER	silent_mutation	Average:50.936; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N
vg0512386404	C -> T	LOC_Os05g21050-LOC_Os05g21060	intergenic_region ; MODIFIER	silent_mutation	Average:50.936; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0512386404	NA	5.13E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404	NA	1.12E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404	4.27E-06	NA	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404	NA	1.26E-11	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404	NA	9.34E-07	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404	NA	3.29E-15	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404	NA	6.38E-13	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404	2.40E-07	NA	mr1301_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404	NA	7.36E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404	NA	8.28E-09	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512386404	NA	3.84E-16	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251