| Variant ID: vg0512386404 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 12386404 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 318. )
GTAACCATAATATACCAAGAGTATTTCTGCACTATTGCTAGGAATTATATTTCTAGTAATGTCGTTAACAAATACCGACAAGCATTTCTGGCGCCGTTGC[C/T]
GGGGAAGATACATAATAGAGATTACCTGAACTAATATTTTGTATTTACCCTCTGTATAATCATTTTCCTTTACAGGCTAACCTTGGTTGTTTTCACTTTT
AAAAGTGAAAACAACCAAGGTTAGCCTGTAAAGGAAAATGATTATACAGAGGGTAAATACAAAATATTAGTTCAGGTAATCTCTATTATGTATCTTCCCC[G/A]
GCAACGGCGCCAGAAATGCTTGTCGGTATTTGTTAACGACATTACTAGAAATATAATTCCTAGCAATAGTGCAGAAATACTCTTGGTATATTATGGTTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.90% | 2.20% | 1.82% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 0.10% | 1.81% | 0.00% | NA |
| All Japonica | 1512 | 91.10% | 6.70% | 2.12% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 95.60% | 0.00% | 4.37% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 0.50% | 2.67% | 0.00% | NA |
| Temperate Japonica | 767 | 96.70% | 1.30% | 1.96% | 0.00% | NA |
| Tropical Japonica | 504 | 84.70% | 13.30% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.70% | 10.40% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 0.00% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0512386404 | C -> T | LOC_Os05g21050.1 | upstream_gene_variant ; 1234.0bp to feature; MODIFIER | silent_mutation | Average:50.936; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| vg0512386404 | C -> T | LOC_Os05g21060.1 | upstream_gene_variant ; 1149.0bp to feature; MODIFIER | silent_mutation | Average:50.936; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| vg0512386404 | C -> T | LOC_Os05g21050-LOC_Os05g21060 | intergenic_region ; MODIFIER | silent_mutation | Average:50.936; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0512386404 | NA | 5.13E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512386404 | NA | 1.12E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512386404 | 4.27E-06 | NA | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512386404 | NA | 1.26E-11 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512386404 | NA | 9.34E-07 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512386404 | NA | 3.29E-15 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512386404 | NA | 6.38E-13 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512386404 | 2.40E-07 | NA | mr1301_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512386404 | NA | 7.36E-12 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512386404 | NA | 8.28E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512386404 | NA | 3.84E-16 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |