\
| Variant ID: vg0512332611 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 12332611 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 327. )
TGGCGACCGATTATTTTACCAAATGGGTGGTGGCAGTTCCATTGAAGAAAGTTGATTATGGGGATGCAATACAGTTTGTCAAGGAGTATATTATCTACCG[A/G]
TTTGGGATTCCTCAGACTATTACAACAGATCAGGGGTCAATCTTTGTATTTGATGAATTTGTTCAGTTTGCCGATAGCATGGGTATCAAGTTGTTGAATT
AATTCAACAACTTGATACCCATGCTATCGGCAAACTGAACAAATTCATCAAATACAAAGATTGACCCCTGATCTGTTGTAATAGTCTGAGGAATCCCAAA[T/C]
CGGTAGATAATATACTCCTTGACAAACTGTATTGCATCCCCATAATCAACTTTCTTCAATGGAACTGCCACCACCCATTTGGTAAAATAATCGGTCGCCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.50% | 4.80% | 0.74% | 0.00% | NA |
| All Indica | 2759 | 90.60% | 8.10% | 1.27% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.00% | 0.67% | 0.00% | NA |
| Indica II | 465 | 77.60% | 19.10% | 3.23% | 0.00% | NA |
| Indica III | 913 | 87.20% | 11.50% | 1.31% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 2.90% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0512332611 | A -> G | LOC_Os05g20960.1 | synonymous_variant ; p.Arg102Arg; LOW | synonymous_codon | Average:40.213; most accessible tissue: Zhenshan97 young leaf, score: 59.612 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0512332611 | 2.53E-16 | 1.04E-41 | mr1039 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512332611 | 3.18E-11 | 1.21E-23 | mr1039 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512332611 | 8.37E-08 | NA | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512332611 | 2.16E-06 | 2.69E-10 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512332611 | NA | 3.53E-06 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512332611 | 5.03E-20 | 7.61E-46 | mr1039_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512332611 | 2.28E-13 | 3.01E-25 | mr1039_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512332611 | 3.09E-07 | NA | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512332611 | 3.06E-06 | NA | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512332611 | NA | 5.54E-08 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512332611 | 7.40E-16 | 1.13E-31 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512332611 | 4.68E-12 | 9.21E-19 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512332611 | NA | 3.67E-09 | mr1715_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |