\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0512292895:

Variant ID: vg0512292895 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 12292895
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGGTTGATATATTTGCCTACCTGATACCTCAATTCTATCCCTAATTGCATTGTGTTTAGAGACGCATCGGTTTAGTTGGGACTGGCTCGGTTAGGTCT[G/A]
ATCTTCTGTCTTAGCCGATATATCTCTACAATCACAATGATGTTCTAAGGCCCTCTTTGTTTAGGCTTAGGCTTATTGGCCTAGACTTTTAAGTCAGTTT

Reverse complement sequence

AAACTGACTTAAAAGTCTAGGCCAATAAGCCTAAGCCTAAACAAAGAGGGCCTTAGAACATCATTGTGATTGTAGAGATATATCGGCTAAGACAGAAGAT[C/T]
AGACCTAACCGAGCCAGTCCCAACTAAACCGATGCGTCTCTAAACACAATGCAATTAGGGATAGAATTGAGGTATCAGGTAGGCAAATATATCAACCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.50% 2.10% 1.35% 0.00% NA
All Indica  2759 99.00% 0.00% 1.01% 0.00% NA
All Japonica  1512 91.30% 6.40% 2.25% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.50% 0.00% 2.52% 0.00% NA
Indica II  465 99.10% 0.00% 0.86% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 99.00% 0.00% 1.02% 0.00% NA
Temperate Japonica  767 94.30% 3.00% 2.74% 0.00% NA
Tropical Japonica  504 89.90% 8.70% 1.39% 0.00% NA
Japonica Intermediate  241 85.10% 12.40% 2.49% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 3.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0512292895 G -> A LOC_Os05g20914.1 upstream_gene_variant ; 1025.0bp to feature; MODIFIER silent_mutation Average:62.193; most accessible tissue: Minghui63 young leaf, score: 79.549 N N N N
vg0512292895 G -> A LOC_Os05g20914.2 upstream_gene_variant ; 1025.0bp to feature; MODIFIER silent_mutation Average:62.193; most accessible tissue: Minghui63 young leaf, score: 79.549 N N N N
vg0512292895 G -> A LOC_Os05g20914.3 upstream_gene_variant ; 1025.0bp to feature; MODIFIER silent_mutation Average:62.193; most accessible tissue: Minghui63 young leaf, score: 79.549 N N N N
vg0512292895 G -> A LOC_Os05g20910-LOC_Os05g20914 intergenic_region ; MODIFIER silent_mutation Average:62.193; most accessible tissue: Minghui63 young leaf, score: 79.549 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0512292895 3.97E-06 3.97E-06 mr1452_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512292895 NA 4.38E-06 mr1821_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251