\
| Variant ID: vg0512292895 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 12292895 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 300. )
TTTGGTTGATATATTTGCCTACCTGATACCTCAATTCTATCCCTAATTGCATTGTGTTTAGAGACGCATCGGTTTAGTTGGGACTGGCTCGGTTAGGTCT[G/A]
ATCTTCTGTCTTAGCCGATATATCTCTACAATCACAATGATGTTCTAAGGCCCTCTTTGTTTAGGCTTAGGCTTATTGGCCTAGACTTTTAAGTCAGTTT
AAACTGACTTAAAAGTCTAGGCCAATAAGCCTAAGCCTAAACAAAGAGGGCCTTAGAACATCATTGTGATTGTAGAGATATATCGGCTAAGACAGAAGAT[C/T]
AGACCTAACCGAGCCAGTCCCAACTAAACCGATGCGTCTCTAAACACAATGCAATTAGGGATAGAATTGAGGTATCAGGTAGGCAAATATATCAACCAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.50% | 2.10% | 1.35% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 0.00% | 1.01% | 0.00% | NA |
| All Japonica | 1512 | 91.30% | 6.40% | 2.25% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 0.00% | 2.52% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.00% | 0.86% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 0.00% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 94.30% | 3.00% | 2.74% | 0.00% | NA |
| Tropical Japonica | 504 | 89.90% | 8.70% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 12.40% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 3.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0512292895 | G -> A | LOC_Os05g20914.1 | upstream_gene_variant ; 1025.0bp to feature; MODIFIER | silent_mutation | Average:62.193; most accessible tissue: Minghui63 young leaf, score: 79.549 | N | N | N | N |
| vg0512292895 | G -> A | LOC_Os05g20914.2 | upstream_gene_variant ; 1025.0bp to feature; MODIFIER | silent_mutation | Average:62.193; most accessible tissue: Minghui63 young leaf, score: 79.549 | N | N | N | N |
| vg0512292895 | G -> A | LOC_Os05g20914.3 | upstream_gene_variant ; 1025.0bp to feature; MODIFIER | silent_mutation | Average:62.193; most accessible tissue: Minghui63 young leaf, score: 79.549 | N | N | N | N |
| vg0512292895 | G -> A | LOC_Os05g20910-LOC_Os05g20914 | intergenic_region ; MODIFIER | silent_mutation | Average:62.193; most accessible tissue: Minghui63 young leaf, score: 79.549 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0512292895 | 3.97E-06 | 3.97E-06 | mr1452_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512292895 | NA | 4.38E-06 | mr1821_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |