\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0512292313:

Variant ID: vg0512292313 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 12292313
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTAACGCCAAAATTTGGTAAGCCCAAAGTCATCATCGGCCTAAAGTTAGTATCGGCTTCAGAGTCTTAGAATCGGCCGATGGGAGTCATCAAATCGGCAG[C/T]
AGTTGTGTTCTTGATGGAGTCGGATCAATTGAAGGAAATTTATCCAGAAGAGTCCGAGTTCAAGGAGGATGCGGCATGGCAAGTGTATCTATTAATTAGG

Reverse complement sequence

CCTAATTAATAGATACACTTGCCATGCCGCATCCTCCTTGAACTCGGACTCTTCTGGATAAATTTCCTTCAATTGATCCGACTCCATCAAGAACACAACT[G/A]
CTGCCGATTTGATGACTCCCATCGGCCGATTCTAAGACTCTGAAGCCGATACTAACTTTAGGCCGATGATGACTTTGGGCTTACCAAATTTTGGCGTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.90% 1.60% 0.49% 0.00% NA
All Indica  2759 96.60% 2.60% 0.80% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 89.40% 8.40% 2.18% 0.00% NA
Indica II  465 99.40% 0.20% 0.43% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 2.50% 0.89% 0.00% NA
Temperate Japonica  767 99.30% 0.50% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0512292313 C -> T LOC_Os05g20914.1 upstream_gene_variant ; 1607.0bp to feature; MODIFIER silent_mutation Average:49.322; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg0512292313 C -> T LOC_Os05g20914.2 upstream_gene_variant ; 1607.0bp to feature; MODIFIER silent_mutation Average:49.322; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg0512292313 C -> T LOC_Os05g20914.3 upstream_gene_variant ; 1607.0bp to feature; MODIFIER silent_mutation Average:49.322; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg0512292313 C -> T LOC_Os05g20910-LOC_Os05g20914 intergenic_region ; MODIFIER silent_mutation Average:49.322; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0512292313 1.80E-07 7.97E-08 mr1349_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512292313 NA 5.30E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512292313 5.67E-06 1.91E-06 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512292313 NA 2.06E-06 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512292313 NA 3.36E-06 mr1749_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512292313 NA 9.49E-07 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251