\
| Variant ID: vg0512292313 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 12292313 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 94. )
TTAACGCCAAAATTTGGTAAGCCCAAAGTCATCATCGGCCTAAAGTTAGTATCGGCTTCAGAGTCTTAGAATCGGCCGATGGGAGTCATCAAATCGGCAG[C/T]
AGTTGTGTTCTTGATGGAGTCGGATCAATTGAAGGAAATTTATCCAGAAGAGTCCGAGTTCAAGGAGGATGCGGCATGGCAAGTGTATCTATTAATTAGG
CCTAATTAATAGATACACTTGCCATGCCGCATCCTCCTTGAACTCGGACTCTTCTGGATAAATTTCCTTCAATTGATCCGACTCCATCAAGAACACAACT[G/A]
CTGCCGATTTGATGACTCCCATCGGCCGATTCTAAGACTCTGAAGCCGATACTAACTTTAGGCCGATGATGACTTTGGGCTTACCAAATTTTGGCGTTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.90% | 1.60% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 96.60% | 2.60% | 0.80% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.40% | 8.40% | 2.18% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 2.50% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0512292313 | C -> T | LOC_Os05g20914.1 | upstream_gene_variant ; 1607.0bp to feature; MODIFIER | silent_mutation | Average:49.322; most accessible tissue: Minghui63 young leaf, score: 65.161 | N | N | N | N |
| vg0512292313 | C -> T | LOC_Os05g20914.2 | upstream_gene_variant ; 1607.0bp to feature; MODIFIER | silent_mutation | Average:49.322; most accessible tissue: Minghui63 young leaf, score: 65.161 | N | N | N | N |
| vg0512292313 | C -> T | LOC_Os05g20914.3 | upstream_gene_variant ; 1607.0bp to feature; MODIFIER | silent_mutation | Average:49.322; most accessible tissue: Minghui63 young leaf, score: 65.161 | N | N | N | N |
| vg0512292313 | C -> T | LOC_Os05g20910-LOC_Os05g20914 | intergenic_region ; MODIFIER | silent_mutation | Average:49.322; most accessible tissue: Minghui63 young leaf, score: 65.161 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0512292313 | 1.80E-07 | 7.97E-08 | mr1349_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512292313 | NA | 5.30E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512292313 | 5.67E-06 | 1.91E-06 | mr1452_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512292313 | NA | 2.06E-06 | mr1576_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512292313 | NA | 3.36E-06 | mr1749_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512292313 | NA | 9.49E-07 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |