\
| Variant ID: vg0512250003 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 12250003 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.01, others allele: 0.00, population size: 191. )
TATAGTACATGGTACTTTTCACTATTTTTTTTTTGCCACGATCAACAAATTCATTGCAATAAAAAAATTGTCGTCTCATAATTTAAATTAATTTTTTCAT[A/G]
TGGACACGGATTGAGACAAATTTTATATGGAAATTATAGCTCTCGACGAGATCTACAATTTTATAGGTGATAACTTTTTCATTTGAAATCTTTTAGATAT
ATATCTAAAAGATTTCAAATGAAAAAGTTATCACCTATAAAATTGTAGATCTCGTCGAGAGCTATAATTTCCATATAAAATTTGTCTCAATCCGTGTCCA[T/C]
ATGAAAAAATTAATTTAAATTATGAGACGACAATTTTTTTATTGCAATGAATTTGTTGATCGTGGCAAAAAAAAAATAGTGAAAAGTACCATGTACTATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 8.70% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 92.60% | 7.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 23.40% | 72.10% | 4.46% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 84.90% | 15.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.40% | 7.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0512250003 | A -> G | LOC_Os05g20860.1 | upstream_gene_variant ; 3413.0bp to feature; MODIFIER | silent_mutation | Average:24.589; most accessible tissue: Zhenshan97 root, score: 36.298 | N | N | N | N |
| vg0512250003 | A -> G | LOC_Os05g20850.1 | downstream_gene_variant ; 4282.0bp to feature; MODIFIER | silent_mutation | Average:24.589; most accessible tissue: Zhenshan97 root, score: 36.298 | N | N | N | N |
| vg0512250003 | A -> G | LOC_Os05g20850-LOC_Os05g20860 | intergenic_region ; MODIFIER | silent_mutation | Average:24.589; most accessible tissue: Zhenshan97 root, score: 36.298 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0512250003 | NA | 7.10E-07 | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512250003 | NA | 8.44E-32 | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512250003 | NA | 2.82E-21 | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512250003 | 3.57E-06 | NA | mr1150_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512250003 | NA | 9.74E-12 | mr1610_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512250003 | NA | 1.28E-09 | mr1818_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512250003 | NA | 5.30E-12 | mr1918_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512250003 | NA | 6.12E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0512250003 | NA | 8.55E-15 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |