Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0512250003:

Variant ID: vg0512250003 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 12250003
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.01, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


TATAGTACATGGTACTTTTCACTATTTTTTTTTTGCCACGATCAACAAATTCATTGCAATAAAAAAATTGTCGTCTCATAATTTAAATTAATTTTTTCAT[A/G]
TGGACACGGATTGAGACAAATTTTATATGGAAATTATAGCTCTCGACGAGATCTACAATTTTATAGGTGATAACTTTTTCATTTGAAATCTTTTAGATAT

Reverse complement sequence

ATATCTAAAAGATTTCAAATGAAAAAGTTATCACCTATAAAATTGTAGATCTCGTCGAGAGCTATAATTTCCATATAAAATTTGTCTCAATCCGTGTCCA[T/C]
ATGAAAAAATTAATTTAAATTATGAGACGACAATTTTTTTATTGCAATGAATTTGTTGATCGTGGCAAAAAAAAAATAGTGAAAAGTACCATGTACTATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 8.70% 0.28% 0.00% NA
All Indica  2759 92.60% 7.30% 0.04% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 23.40% 72.10% 4.46% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 84.90% 15.10% 0.00% 0.00% NA
Indica Intermediate  786 92.40% 7.50% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0512250003 A -> G LOC_Os05g20860.1 upstream_gene_variant ; 3413.0bp to feature; MODIFIER silent_mutation Average:24.589; most accessible tissue: Zhenshan97 root, score: 36.298 N N N N
vg0512250003 A -> G LOC_Os05g20850.1 downstream_gene_variant ; 4282.0bp to feature; MODIFIER silent_mutation Average:24.589; most accessible tissue: Zhenshan97 root, score: 36.298 N N N N
vg0512250003 A -> G LOC_Os05g20850-LOC_Os05g20860 intergenic_region ; MODIFIER silent_mutation Average:24.589; most accessible tissue: Zhenshan97 root, score: 36.298 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0512250003 NA 7.10E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512250003 NA 8.44E-32 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512250003 NA 2.82E-21 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512250003 3.57E-06 NA mr1150_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512250003 NA 9.74E-12 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512250003 NA 1.28E-09 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512250003 NA 5.30E-12 mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512250003 NA 6.12E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512250003 NA 8.55E-15 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251