Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0512094471:

Variant ID: vg0512094471 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 12094471
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTCCATGAAGATCGAATGGCGTTGGACGCCATTTGCAGCGCCGTCCCCGTCGAGATGATCTCGACGCTAGCGACCAAGGAGACGACGAAGGCAGCGTGG[A/G]
ACTGCATCAAGACCATGCGCGTAGGCAAGCCGAGTGCACAGAAGCTGCGCTCCGAGTACGAGGCTCTCGCGTTCCGCGACGGGGTGTCGGTCGAGGACAT

Reverse complement sequence

ATGTCCTCGACCGACACCCCGTCGCGGAACGCGAGAGCCTCGTACTCGGAGCGCAGCTTCTGTGCACTCGGCTTGCCTACGCGCATGGTCTTGATGCAGT[T/C]
CCACGCTGCCTTCGTCGTCTCCTTGGTCGCTAGCGTCGAGATCATCTCGACGGGGACGGCGCTGCAAATGGCGTCCAACGCCATTCGATCTTCATGGAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 18.10% 10.11% 0.00% NA
All Indica  2759 82.50% 5.60% 11.96% 0.00% NA
All Japonica  1512 45.90% 45.40% 8.73% 0.00% NA
Aus  269 98.50% 0.00% 1.49% 0.00% NA
Indica I  595 58.00% 13.90% 28.07% 0.00% NA
Indica II  465 83.20% 5.60% 11.18% 0.00% NA
Indica III  913 99.20% 0.30% 0.44% 0.00% NA
Indica Intermediate  786 81.00% 5.30% 13.61% 0.00% NA
Temperate Japonica  767 13.40% 76.00% 10.56% 0.00% NA
Tropical Japonica  504 87.90% 7.10% 4.96% 0.00% NA
Japonica Intermediate  241 61.40% 27.80% 10.79% 0.00% NA
VI/Aromatic  96 93.80% 2.10% 4.17% 0.00% NA
Intermediate  90 74.40% 16.70% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0512094471 A -> G LOC_Os05g20620.1 missense_variant ; p.Asn51Asp; MODERATE nonsynonymous_codon Average:79.077; most accessible tissue: Zhenshan97 young leaf, score: 92.764 benign -0.419 TOLERATED 0.75
vg0512094471 A -> G LOC_Os05g20620.2 missense_variant ; p.Asn51Asp; MODERATE nonsynonymous_codon Average:79.077; most accessible tissue: Zhenshan97 young leaf, score: 92.764 benign -0.419 TOLERATED 0.75

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0512094471 A G 0.02 0.02 0.01 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0512094471 1.83E-06 1.83E-06 mr1261 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512094471 NA 1.20E-10 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512094471 NA 2.51E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512094471 NA 4.68E-08 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512094471 NA 5.26E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512094471 NA 5.07E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0512094471 NA 9.10E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251