\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0511756975:

Variant ID: vg0511756975 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 11756975
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAACTAATAAAATACTAAACTTTGAGTCCTAGCTGGTACGATTTCTTATTTATGAATTACAAATTTCTGAACAATTATATTAGAGTCCACGTTATTTTC[G/A]
ATTTTATGATTACTATATCTATACTTTCTATAAAGTTATACTCACTAAGTTTAAATCTCAACATCCAACTATGCCACATCATCACCCACTAGTAATAATT

Reverse complement sequence

AATTATTACTAGTGGGTGATGATGTGGCATAGTTGGATGTTGAGATTTAAACTTAGTGAGTATAACTTTATAGAAAGTATAGATATAGTAATCATAAAAT[C/T]
GAAAATAACGTGGACTCTAATATAATTGTTCAGAAATTTGTAATTCATAAATAAGAAATCGTACCAGCTAGGACTCAAAGTTTAGTATTTTATTAGTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.30% 2.20% 0.49% 0.00% NA
All Indica  2759 95.40% 3.70% 0.83% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 77.80% 18.90% 3.23% 0.00% NA
Indica III  913 99.20% 0.50% 0.22% 0.00% NA
Indica Intermediate  786 98.20% 1.30% 0.51% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0511756975 G -> A LOC_Os05g20100.1 upstream_gene_variant ; 594.0bp to feature; MODIFIER silent_mutation Average:33.362; most accessible tissue: Callus, score: 62.045 N N N N
vg0511756975 G -> A LOC_Os05g20100-LOC_Os05g20110 intergenic_region ; MODIFIER silent_mutation Average:33.362; most accessible tissue: Callus, score: 62.045 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0511756975 NA 1.66E-29 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511756975 NA 6.13E-17 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511756975 2.11E-07 NA mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511756975 1.62E-06 2.68E-08 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511756975 NA 4.27E-06 mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511756975 2.22E-09 1.10E-33 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511756975 1.20E-06 2.12E-19 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511756975 NA 7.46E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511756975 1.09E-07 NA mr1514_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511756975 5.32E-07 6.13E-06 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511756975 3.47E-12 NA mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511756975 1.90E-10 1.74E-18 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251