\
| Variant ID: vg0511756975 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 11756975 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAAACTAATAAAATACTAAACTTTGAGTCCTAGCTGGTACGATTTCTTATTTATGAATTACAAATTTCTGAACAATTATATTAGAGTCCACGTTATTTTC[G/A]
ATTTTATGATTACTATATCTATACTTTCTATAAAGTTATACTCACTAAGTTTAAATCTCAACATCCAACTATGCCACATCATCACCCACTAGTAATAATT
AATTATTACTAGTGGGTGATGATGTGGCATAGTTGGATGTTGAGATTTAAACTTAGTGAGTATAACTTTATAGAAAGTATAGATATAGTAATCATAAAAT[C/T]
GAAAATAACGTGGACTCTAATATAATTGTTCAGAAATTTGTAATTCATAAATAAGAAATCGTACCAGCTAGGACTCAAAGTTTAGTATTTTATTAGTTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.30% | 2.20% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 95.40% | 3.70% | 0.83% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 77.80% | 18.90% | 3.23% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 98.20% | 1.30% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0511756975 | G -> A | LOC_Os05g20100.1 | upstream_gene_variant ; 594.0bp to feature; MODIFIER | silent_mutation | Average:33.362; most accessible tissue: Callus, score: 62.045 | N | N | N | N |
| vg0511756975 | G -> A | LOC_Os05g20100-LOC_Os05g20110 | intergenic_region ; MODIFIER | silent_mutation | Average:33.362; most accessible tissue: Callus, score: 62.045 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0511756975 | NA | 1.66E-29 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511756975 | NA | 6.13E-17 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511756975 | 2.11E-07 | NA | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511756975 | 1.62E-06 | 2.68E-08 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511756975 | NA | 4.27E-06 | mr1651 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511756975 | 2.22E-09 | 1.10E-33 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511756975 | 1.20E-06 | 2.12E-19 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511756975 | NA | 7.46E-06 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511756975 | 1.09E-07 | NA | mr1514_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511756975 | 5.32E-07 | 6.13E-06 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511756975 | 3.47E-12 | NA | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511756975 | 1.90E-10 | 1.74E-18 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |