\
| Variant ID: vg0511662961 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 11662961 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 295. )
CCAGGGTGCTGACCGATCTCAGTGGTGTCTAGGTTGTGCTCGGAACTGATTTCTTGAATACTGGTCCAATGCAAACCATTCCACTTGAGCATTTTTTATC[T/C]
GTATGAATAATTTGGTTTACTAACCTAGAAGTATTTAATTAAAACCAATTTATATCAGTTATGTTGGATACAGTATTAATGTAGTAATATAATATTGGGG
CCCCAATATTATATTACTACATTAATACTGTATCCAACATAACTGATATAAATTGGTTTTAATTAAATACTTCTAGGTTAGTAAACCAAATTATTCATAC[A/G]
GATAAAAAATGCTCAAGTGGAATGGTTTGCATTGGACCAGTATTCAAGAAATCAGTTCCGAGCACAACCTAGACACCACTGAGATCGGTCAGCACCCTGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.90% | 2.60% | 0.53% | 0.00% | NA |
| All Indica | 2759 | 94.80% | 4.30% | 0.91% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.00% | 0.84% | 0.00% | NA |
| Indica II | 465 | 74.20% | 22.80% | 3.01% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 1.50% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0511662961 | T -> C | LOC_Os05g19970.1 | intron_variant ; MODIFIER | silent_mutation | Average:53.216; most accessible tissue: Zhenshan97 young leaf, score: 72.34 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0511662961 | 4.22E-13 | 2.29E-39 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511662961 | 6.03E-09 | 5.88E-23 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511662961 | 2.37E-09 | NA | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511662961 | 8.51E-08 | 1.74E-11 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511662961 | 6.37E-19 | 4.80E-45 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511662961 | 2.29E-12 | 9.15E-26 | mr1039_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511662961 | NA | 2.86E-06 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511662961 | 6.23E-07 | NA | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511662961 | 3.63E-06 | NA | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511662961 | NA | 1.04E-08 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511662961 | 1.07E-18 | 6.18E-34 | mr1632_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511662961 | 4.12E-14 | 1.75E-21 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511662961 | NA | 5.92E-10 | mr1715_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |