\
| Variant ID: vg0511404761 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 11404761 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGAGTACGCATGGCAGCACAAGAAGCAGACCTCCAACAAGGCGCAAAATTTATCGCCAAGATCCGGGAGTCGATCAGAGCCGAGTGACCTCTGAATTCGA[C/T]
GAGAAGCTTTGAGAAGAGCAACAGAACCCGGAGGCTGCCGCTGCTGCTGCGCAAGAAGAGTTAGCAGGTCCCACCCAAAGGCGCAGCAGTTGCGCATCAA
TTGATGCGCAACTGCTGCGCCTTTGGGTGGGACCTGCTAACTCTTCTTGCGCAGCAGCAGCGGCAGCCTCCGGGTTCTGTTGCTCTTCTCAAAGCTTCTC[G/A]
TCGAATTCAGAGGTCACTCGGCTCTGATCGACTCCCGGATCTTGGCGATAAATTTTGCGCCTTGTTGGAGGTCTGCTTCTTGTGCTGCCATGCGTACTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.70% | 12.10% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 89.30% | 10.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 96.00% | 3.40% | 0.60% | 0.00% | NA |
| Aus | 269 | 20.40% | 79.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 79.00% | 21.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.30% | 11.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.90% | 8.70% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 3.30% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0511404761 | C -> T | LOC_Os05g19580.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.981; most accessible tissue: Zhenshan97 young leaf, score: 73.923 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0511404761 | NA | 2.46E-09 | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511404761 | NA | 5.98E-07 | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511404761 | NA | 3.29E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511404761 | NA | 1.27E-10 | mr1317_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511404761 | NA | 6.13E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511404761 | NA | 6.88E-12 | mr1610_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511404761 | NA | 1.51E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511404761 | NA | 1.65E-11 | mr1818_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511404761 | 5.23E-08 | NA | mr1850_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511404761 | NA | 5.16E-11 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511404761 | NA | 2.79E-12 | mr1914_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0511404761 | NA | 3.73E-17 | mr1927_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |