\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0510889800:

Variant ID: vg0510889800 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 10889800
Reference Allele: ATTTTAlternative Allele: ATTT,TTTTT,AT,ATT,A,ATTTTT
Primary Allele: ATTTTSecondary Allele: ATTT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTTCCGCCGGCTGATGGAAGGTGAGAGAGGAAAAAATGTGAGAGAGAGAAGGGGGAGGTAAGGATGAAATGTGGGGTCCACATGTGGGTGGGTTCTACT[ATTTT/ATTT,TTTTT,AT,ATT,A,ATTTTT]
TTTTTTTTGTGTGAATGACACGTCGGTCCCACAATTTTTTTTACTCTAATGCCACATAAGCGACACGTCGACGACACGCGGGACGATGACCGGGTCAACA

Reverse complement sequence

TGTTGACCCGGTCATCGTCCCGCGTGTCGTCGACGTGTCGCTTATGTGGCATTAGAGTAAAAAAAATTGTGGGACCGACGTGTCATTCACACAAAAAAAA[AAAAT/AAAT,AAAAA,AT,AAT,T,AAAAAT]
AGTAGAACCCACCCACATGTGGACCCCACATTTCATCCTTACCTCCCCCTTCTCTCTCTCACATTTTTTCCTCTCTCACCTTCCATCAGCCGGCGGAAGC

Allele Frequencies:

Populations Population SizeFrequency of ATTTT(primary allele) Frequency of ATTT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.80% 13.50% 13.54% 0.00% AT: 9.80%; TTTTT: 4.55%; ATT: 4.19%; A: 1.02%; ATTTTT: 0.57%
All Indica  2759 56.00% 10.10% 12.83% 0.00% AT: 8.34%; TTTTT: 7.03%; ATT: 3.66%; A: 1.63%; ATTTTT: 0.40%
All Japonica  1512 53.60% 21.80% 16.20% 0.00% ATT: 5.69%; ATTTTT: 0.99%; TTTTT: 0.86%; AT: 0.79%
Aus  269 14.10% 3.30% 2.60% 0.00% AT: 78.07%; ATT: 1.12%; A: 0.74%
Indica I  595 58.30% 1.70% 22.18% 0.00% TTTTT: 10.25%; ATT: 7.39%; A: 0.17%
Indica II  465 50.10% 17.40% 17.42% 0.00% TTTTT: 12.26%; ATT: 1.94%; AT: 0.86%
Indica III  913 51.60% 16.50% 5.59% 0.00% AT: 17.74%; TTTTT: 2.96%; A: 2.85%; ATT: 1.64%; ATTTTT: 1.10%
Indica Intermediate  786 63.00% 4.60% 11.45% 0.00% AT: 8.14%; TTTTT: 6.23%; ATT: 4.20%; A: 2.29%; ATTTTT: 0.13%
Temperate Japonica  767 70.10% 5.20% 20.47% 0.00% ATTTTT: 1.83%; TTTTT: 1.43%; AT: 0.52%; ATT: 0.39%
Tropical Japonica  504 25.40% 46.20% 11.31% 0.00% ATT: 15.48%; AT: 1.39%; TTTTT: 0.20%
Japonica Intermediate  241 60.20% 23.70% 12.86% 0.00% ATT: 2.07%; AT: 0.41%; TTTTT: 0.41%; ATTTTT: 0.41%
VI/Aromatic  96 57.30% 15.60% 19.79% 0.00% ATT: 5.21%; AT: 1.04%; ATTTTT: 1.04%
Intermediate  90 51.10% 7.80% 16.67% 0.00% AT: 11.11%; TTTTT: 8.89%; ATT: 3.33%; A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0510889800 ATTTT -> ATTTTT LOC_Os05g18770.1 upstream_gene_variant ; 3036.0bp to feature; MODIFIER silent_mutation Average:88.151; most accessible tissue: Zhenshan97 young leaf, score: 92.818 N N N N
vg0510889800 ATTTT -> ATTTTT LOC_Os05g18770-LOC_Os05g18774 intergenic_region ; MODIFIER silent_mutation Average:88.151; most accessible tissue: Zhenshan97 young leaf, score: 92.818 N N N N
vg0510889800 ATTTT -> ATTT LOC_Os05g18770.1 upstream_gene_variant ; 3035.0bp to feature; MODIFIER silent_mutation Average:88.151; most accessible tissue: Zhenshan97 young leaf, score: 92.818 N N N N
vg0510889800 ATTTT -> ATTT LOC_Os05g18770-LOC_Os05g18774 intergenic_region ; MODIFIER silent_mutation Average:88.151; most accessible tissue: Zhenshan97 young leaf, score: 92.818 N N N N
vg0510889800 ATTTT -> TTTTT LOC_Os05g18770.1 upstream_gene_variant ; 3031.0bp to feature; MODIFIER silent_mutation Average:88.151; most accessible tissue: Zhenshan97 young leaf, score: 92.818 N N N N
vg0510889800 ATTTT -> TTTTT LOC_Os05g18770-LOC_Os05g18774 intergenic_region ; MODIFIER silent_mutation Average:88.151; most accessible tissue: Zhenshan97 young leaf, score: 92.818 N N N N
vg0510889800 ATTTT -> AT LOC_Os05g18770.1 upstream_gene_variant ; 3033.0bp to feature; MODIFIER silent_mutation Average:88.151; most accessible tissue: Zhenshan97 young leaf, score: 92.818 N N N N
vg0510889800 ATTTT -> AT LOC_Os05g18770-LOC_Os05g18774 intergenic_region ; MODIFIER silent_mutation Average:88.151; most accessible tissue: Zhenshan97 young leaf, score: 92.818 N N N N
vg0510889800 ATTTT -> ATT LOC_Os05g18770.1 upstream_gene_variant ; 3034.0bp to feature; MODIFIER silent_mutation Average:88.151; most accessible tissue: Zhenshan97 young leaf, score: 92.818 N N N N
vg0510889800 ATTTT -> ATT LOC_Os05g18770-LOC_Os05g18774 intergenic_region ; MODIFIER silent_mutation Average:88.151; most accessible tissue: Zhenshan97 young leaf, score: 92.818 N N N N
vg0510889800 ATTTT -> A LOC_Os05g18770.1 upstream_gene_variant ; 3032.0bp to feature; MODIFIER silent_mutation Average:88.151; most accessible tissue: Zhenshan97 young leaf, score: 92.818 N N N N
vg0510889800 ATTTT -> A LOC_Os05g18770-LOC_Os05g18774 intergenic_region ; MODIFIER silent_mutation Average:88.151; most accessible tissue: Zhenshan97 young leaf, score: 92.818 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0510889800 ATTTT A -0.27 -0.17 -0.18 -0.11 -0.14 -0.11
vg0510889800 ATTTT AT -0.57 -0.39 -0.38 -0.36 -0.41 -0.37
vg0510889800 ATTTT ATT -0.45 -0.29 -0.28 -0.35 -0.39 -0.41
vg0510889800 ATTTT ATTT 0.15 0.19 0.21 0.14 0.18 0.17
vg0510889800 ATTTT ATTTT* 0.41 0.27 0.23 0.16 0.21 0.2
vg0510889800 ATTTT TTTTT 0.01 0.0 0.0 0.02 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0510889800 9.89E-07 9.89E-07 mr1738 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251