\
| Variant ID: vg0510448104 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 10448104 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )
TAGATGAGTCTGGTTCTCGTTTGCTTACTTTGCAATTTCTGTGCACTTTGAAAGAAATAGAAGATGGTATTTCTTTTCGCCTTTTCCGTAAGGAGTTCAC[G/A,T]
CTCACATGGAAAGGCTTGAGTACACTTCTTGTTTTTCACGATTCCTTTAAAATCGATCTCCAGAAAGGAATTTCTTGGTTCAAGAAAAATAGGTTTTGGG
CCCAAAACCTATTTTTCTTGAACCAAGAAATTCCTTTCTGGAGATCGATTTTAAAGGAATCGTGAAAAACAAGAAGTGTACTCAAGCCTTTCCATGTGAG[C/T,A]
GTGAACTCCTTACGGAAAAGGCGAAAAGAAATACCATCTTCTATTTCTTTCAAAGTGCACAGAAATTGCAAAGTAAGCAAACGAGAACCAGACTCATCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.30% | 2.30% | 0.44% | 0.00% | NA |
| All Indica | 2759 | 95.40% | 3.80% | 0.76% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 76.80% | 20.20% | 3.01% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 1.40% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0510448104 | G -> T | LOC_Os05g18180.1 | synonymous_variant ; p.Thr103Thr; LOW | N | Average:26.24; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 | N | N | N | N |
| vg0510448104 | G -> T | LOC_Os05g18190.1 | upstream_gene_variant ; 4058.0bp to feature; MODIFIER | N | Average:26.24; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 | N | N | N | N |
| vg0510448104 | G -> T | LOC_Os05g18170.1 | downstream_gene_variant ; 1011.0bp to feature; MODIFIER | N | Average:26.24; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 | N | N | N | N |
| vg0510448104 | G -> A | LOC_Os05g18180.1 | synonymous_variant ; p.Thr103Thr; LOW | synonymous_codon | Average:26.24; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0510448104 | 1.58E-09 | 9.58E-36 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510448104 | 1.15E-06 | 1.09E-20 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510448104 | 9.59E-12 | NA | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510448104 | 8.42E-10 | 1.60E-12 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510448104 | 1.58E-15 | 3.65E-42 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510448104 | 1.40E-10 | 4.07E-24 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510448104 | 5.80E-07 | NA | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510448104 | 3.52E-06 | 5.01E-06 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510448104 | 1.09E-18 | 2.85E-34 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510448104 | 4.26E-14 | 4.21E-22 | mr1632_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |