\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0510448104:

Variant ID: vg0510448104 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 10448104
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


TAGATGAGTCTGGTTCTCGTTTGCTTACTTTGCAATTTCTGTGCACTTTGAAAGAAATAGAAGATGGTATTTCTTTTCGCCTTTTCCGTAAGGAGTTCAC[G/A,T]
CTCACATGGAAAGGCTTGAGTACACTTCTTGTTTTTCACGATTCCTTTAAAATCGATCTCCAGAAAGGAATTTCTTGGTTCAAGAAAAATAGGTTTTGGG

Reverse complement sequence

CCCAAAACCTATTTTTCTTGAACCAAGAAATTCCTTTCTGGAGATCGATTTTAAAGGAATCGTGAAAAACAAGAAGTGTACTCAAGCCTTTCCATGTGAG[C/T,A]
GTGAACTCCTTACGGAAAAGGCGAAAAGAAATACCATCTTCTATTTCTTTCAAAGTGCACAGAAATTGCAAAGTAAGCAAACGAGAACCAGACTCATCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.30% 2.30% 0.44% 0.00% NA
All Indica  2759 95.40% 3.80% 0.76% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 76.80% 20.20% 3.01% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 1.40% 0.64% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0510448104 G -> T LOC_Os05g18180.1 synonymous_variant ; p.Thr103Thr; LOW N Average:26.24; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg0510448104 G -> T LOC_Os05g18190.1 upstream_gene_variant ; 4058.0bp to feature; MODIFIER N Average:26.24; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg0510448104 G -> T LOC_Os05g18170.1 downstream_gene_variant ; 1011.0bp to feature; MODIFIER N Average:26.24; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg0510448104 G -> A LOC_Os05g18180.1 synonymous_variant ; p.Thr103Thr; LOW synonymous_codon Average:26.24; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0510448104 1.58E-09 9.58E-36 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104 1.15E-06 1.09E-20 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104 9.59E-12 NA mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104 8.42E-10 1.60E-12 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104 1.58E-15 3.65E-42 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104 1.40E-10 4.07E-24 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104 5.80E-07 NA mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104 3.52E-06 5.01E-06 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104 1.09E-18 2.85E-34 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510448104 4.26E-14 4.21E-22 mr1632_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251